From: Pseudomonas fluorescens: a potential food spoiler and challenges and advances in its detection
Strains used | Target site | Primers | Probe | Amplification conditions | References |
---|---|---|---|---|---|
Laboratory isolates | 16S rRNA DNA 16S–23S intergenic spacer (ITS1) 16S rRNA gene partial region | 16SF 5′ AGAGTTTGATCCTGGCTCAG-3′ 16SR 5′-CTACGGCTACCTTGTTACGA-3′) (16F945 5′-GGGCCCGCACAAGCGGTGG-3′; 23R458 5′-CTTTCCCTCACGGTAC-3′) (16SPSEfluF 5′-TGCATTCAAAACTGACTG-3′; 16SPSER 5′AATCACACCGTGGTAACCG-3′) | NA | 2 min at 94 °C; 5 cycles consisting of 94 °C for 45 s, 55 °C for 1 min, 72 °C for 2 min; 35 cycles consisting of 92 °C for 45 s, 60 °C for 45 s, 72 °C for 2 min; final extension of 72 °C for 2 min and final cooling at 4 °C 5 min at 94 °C; 30 cycles consisting of 94 °C for 1 min, 72 °C for 2 min; final extension of 72 °C for 2 min | Franzetti and Scarpellini (2007) |
Laboratory isolates | 16S rDNA | forward 5′-CTACGGGAGGCAGCAGTGG-3′ and reverse 5′-TCGGTAACGTCAAAACAGCAAAGT-3′ | NA | NS | Márta (2012) |
Laboratory isolates | 16S rDNA metalloprotease gene (aprX) | F:5′-TGCATTCAAAACTGACTG-3 R:5′-AATCACACCGTGGTAACCG-3′ SM2F (5′-AAA-TCG-ATA-GCT-TCA-GCC-AT-3′), SM3R (5′-TTG-AGG-TTG-ATC-TTC-TGG-TT-3′) | NA | 2 min at 94 °C for 1 cycles, 35 cycles of 45 s at 94 °C, 45 s at 59 °C, 2 min at 68 °C with 1 final extension of 5 min at 72 °C and cooling at 4 °C | Al-Rodhan and Nasear (2016) |
Laboratory isolates | 16S DNA 16S rRNA gene partial region alkaline protease gene AprX | PA-GS-F (GACGGGTGAGTAATGCCTA) and PA-GS-R (CACTGGTGTTCCTTCCTATA) 16SPS EfluF (TG-CATTCAAAACTGACTG) and 16SPSER (AATCA-CACCGTGGTAACCG) FP apr I (TAYGGBTTCAAYTCCAAYAC) and RF apr II (VGCGATSGAMACRTTRCC) | NA | NS | Hammad (2015) |
Referred strains | alkaline protease gene aprX | F/5′-ACCGAGAACACCAGCTTGTC-3′ R/5′-CTCACGGTCAATGGCAAAC-3′ | 5′-CTCACGGTCAATGGCAAACTTTTTTTTTTTTTTTTTTTTT-3′ | Denaturation at 94 °C for 5 min followed by 35 cycles of amplification at 94 °C for 20 s, annealing at 58 °C for 20 s, extension at 72 °C for 20 s final extension at 72 °C for 7 min | Chiang et al. (2012) |
Laboratory isolates | partial sequence rpoB gene aprX | PSF (5′-AGTTCA-TGG-ACC-AGA-ACA-ACC-3′) as forward/rpoB-PTR (5′-CCT-TGA-CGG-TGA-ACT-CGT-TTC-3′) as reverse SM2F (5′-AAA-TCG-ATA-GCT-TCA-GCC-AT- 3′)/SM3R (5′-TTG-AGG-TTG-ATC-TTC-TGG-TT-3′ | NA | Denaturation at 94 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and elongation at 72 °C for 1 min, final extension at 72 °C for 10 min Initial denaturation at 95 °C fpr 5 min followed by 30 cycles with denaturation for 30 s at 95 °C, annealing for 30 s at 60 °C, extension for 1 min at 72 °C and final elongation at 72 °C for 8 min | Decimo et al. (2014) |
Laboratory isolates | 16S rRNA | PA-GS-F (5′-GACGGGTGAGTAATGCCTA-3′) and PA-GS-R (5′-CACTGGTGTTCCTTCCTATA-3′) | NA | 95 °C denaturation for 5 min, 10 cycles at 94 °C for 15 s, annealing at 53 °C for 30 s and elongation at 72 °C for 45 s 25 cycles repeated increasing elongation step at 72 °C by 5 s every cycle and final extension at 72 °C for 10 min | Ardura et al. (2013) |
Referred strains | 16S rRNA DNA 16S–23S intergenic spacer (ITS1) 16S rRNA gene partial region | 16SF 5′ AGAGTTTGATCCTGGCTCAG-3′ 16SR 5′-CTACGGCTACCTTGTTACGA-3′) (16F945 5′-GGGCCCGCACAAGCGGTGG-3′; 23R458 5′-CTTTCCCTCACGGTAC-3′) (16SPSEfluF 5′-TGCATTCAAAACTGACTG-3′; 16SPSER 5′AATCACACCGTGGTAACCG-3′) | NA | 2 min at 94 °C; 5 cycles consisting of 94 °C for 45 s, 55 °C for 1 min, 72 °C for 2 min; 35 cycles consisting of 92 °C for 45 s, 60 °C for 45 s, 72 °C for 12 min; final extension of 72 °C for 2 min and final cooling at 4 °C 5 min at 94 °C; 30 cycles consisting of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 2 min; final extension of 72 °C for 2 min | Scarpellini et al. (2004) |
Laboratory isolates | odc (ornithine decarboxylase) | PUT2-F ATHWGNTWYGGNAAYACNATHAARAA PUT2-R GCNARNCCNCCRAAYTTNCCDATRTC | NA | 10 min enzyme activation at 95 °C, followed by 30 cycles of 30 s at 95 °C, 30 s at 53 °C and 2 min at 72 °C and final extension 20 min at 72 °C | De las Rivas et al. (2006) |
Laboratory isolates | alkaline protease gene AprX | FP apr I (TAYGGBTTCAAYTCCAAYAC) and RF apr II (VGCGATSGAMACRTTRCC) | NA | 1 min denaturation at 94 °C, 30 s annealing at 55 °C and a 30 s extension at 72 °C | Martins et al. (2005) |
Laboratory isolates | 16S rRNA gene partial region | 16SPS EfluF (TG-CATTCAAAACTGACTG) and 16SPSER (AATCA-CACCGTGGTAACCG) | NA | NS | Caldera and Franzetti (2014) |
Laboratory isolates | 16S rRNA gene partial region | 16SPS EfluF (TG-CATTCAAAACTGACTG) and 16SPSER (AATCA-CACCGTGGTAACCG) | NA | 1 min at 94 °C; 30 cycles consisting of 56 °C for30 s, 72 °C for 1 min; a final extension of 72 °C for 7 min; final cooling at 4 °C | Morales et al. (2016) |