Skip to main content

Table 1 Primers for amplification of sbi gene

From: IgY antibodies of chicken do not bind staphylococcal binder of immunoglobulin (Sbi) from Staphylococcus aureus

Primer Sequence (5′-3′) Primer length Size of product
Sbi-F aCGCGGATCCAACACGCAACAAACTTCAAC 29 1167 bp
Sbi-R bCCGGAATTC[TTA]TGATGATGCAGTTTCTTGAG 32
  1. aLetters in bold and italics refer to restriction recognition sites
  2. b[TTA] refers to the end codon placed in the primer