High-throughput sequencing analysis reveals genomic similarity in phenotypic heterogeneous Photorhabdus luminescens cell populations

Table 2 Primers used for amplification of the respective genes carrying point mutations identified by HTS analysis. Primers were used for the gene amplification and further sequencing

Primer name	Sequence (5′→3′)	Gene
PluDJC_00175 fwd	cccaatattgcggtttctgg	PluDJC_00175 (phage tail collar domain)
PluDJC_00175 rev	ctccatatgtaaccctgtc	PluDJC_00175 (phage tail collar domain)
PluDJC_15370 fwd	ccagcacactgcttcaacac	PluDJC_15370 (phage tail collar domain)
PluDJC_15370 rev	cccttgaatgaggtgctgca	PluDJC_15370 (phage tail collar domain)
PluDJC_15455 fwd	gcatggtagattgtcagcca	PluDJC_15455 (phage tail collar and fiber domain)
PluDJC_15455 rev	acctatggggataacggt	PluDJC_15455 (phage tail collar and fiber domain)
rpoD fwd	ctataagtgggcagcggcaa	rpoD (PluDJC_19710)
rpoD rev	tcaccggatggaaaacgac	rpoD (PluDJC_19710)
hexA fwd	cgaggagctaatacctcctt	P_hexA + hexA (PluDJC_15800)
hexA+Prom rev	ttctttgacgtgagtcag	P_hexA + hexA (PluDJC_15800)
hfq fwd	cgttcaaacaaaggtgcgac	P_hfq +hfq (PluDJC_22705)
hfq+Prom rev	ccagagcaagctttaagcac	P_hfq +hfq (PluDJC_22705)

ISSN: 1869-2044