Skip to main content

Table 1 Specific primers

From: The function of uridine diphosphate glucose pyrophosphorylase in the lyophilization-stress response of Lactobacillus acidophilus

Genes Note Primers
16S RNA 16S RNA GTCGTGAGATGTTGGGTTA
CTTTATGGGATTTGCTTGA
Sca_1902 Glutathione S-transferase GGTCAAATCAACCCTAAT
CCTTCTTCTACACCCATA
Sca_2009 Fructosamine-3-kinase TCGTCGTTTAGATCACTTAC
AATAGGGATGCCTTACTTT
alaS Alanine–tRNA ligase AGTCGCAACTGTTCCTAAA
AATGAATTGTAATGCCTCTG
argR Arginine repressor TTGAAGGAACAGGGAACT
TGTATCATCACCGCAAAT
clpC ATP-binding subunit ClpC AGAATCAATGTTCGGAGAC
TGTTGAATACATCTGGGTG
cysK Cysteine synthase AAACCCTGCCAATCCACT
ACGTACCGCCTGTACCAA
ddh Lactate dehydrogenase TAAAGGATTATGACGGAGTT
GCTATCGAGCTTGGTGAA
gapB Glyceraldehyde-3-phosphate dehydrogenase GTTTCAGACCGTAATCCA
TCTTCAACATCAAGGCTAT
katE Catalase AGACCAACCGATGACTACAA
ACACGCTCAGGAATACGC
murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase GTATTGAAGCGGGAACA
GAAGCCAGGATGAGGTA