Metabolic capacities and toxigenic potential as key drivers of Bacillus cereus ubiquity and adaptation

Annals of Microbiology

Table 2 Nucleotide sequences, locations and references of the B. cereus virulence-related gene PCR primers

Primer set and reference	Primer name^a and sequence (5′→ 3′)	Target gene	Expected size (bp)
Hemolysin A (cereolysinO) (Raddadi et al. 2006)	FHEMAF : CGTGAGAAAGCAAAACGC	hlyA	725
Hemolysin A (cereolysinO) (Raddadi et al. 2006)	FHEMAR : TCAACAGAAACTGGAGAATGAT)	hlyA	725
Hemolysin II (Fagerlund et al. 2004)	FHLY II : GATTCTAAAGGAACTGTAG	hlyII	868
Hemolysin II (Fagerlund et al. 2004)	RHLY II : GGTTATCAAGAGTAACTTG	hlyII	868
Non hemolytic enterotoxin (NHE) (Hansen and Hendriksen 2001)	nheA 344S : TACGCTAAGGAGGGGCA	nheA	499
	nheA 843A : GTTTTTATTGCTTCATCGGCT	nheA	499
S-D-Bact-1494-a-S-20 (Jensen et al. 1993)	1494ADNr 16S: GTCGTAACAAGGTAGCCGTA	ITS 16–23S rDNA profiles
S-D-Bact-0035-a-A-15 (Jensen et al. 1993)	35 ADNr 23S: CAAGGCATCCACCGT	ITS 16–23S rDNA profiles
Hemolysin BL (HBL) (Hansen and Hendriksen 2001)	HBLA1: GTGCAGATGTTGATGCCGAT	hblA	319
Hemolysin BL (HBL) (Hansen and Hendriksen 2001)	HBLA2: ATGCCACTGCGTGGACATAT	hblA	319
EM1 (Ehling-Schulz et al. 2004)	EM1F: GACAAGAGAAATTTCTACGAGCAAGTACAAT	Cereulide synthetase (ces) gene cluster	635
EM1 (Ehling-Schulz et al. 2004)	EM1R: GCAGCCTTCCAATTACTCCTTCTGCCACAGT	Cereulide synthetase (ces) gene cluster	635
Cytotoxin K2 (Guinebretière et al. 2006)	CytK2R: GTG IAG CCT GGA CGA AGT TGG	CytK2	585
Cytotoxin K2 (Guinebretière et al. 2006)	CytK2 F: CAA TCC CTG GCG CTA GTG CA	CytK2	585
Cytotoxin K1 (Guinebretière et al. 2006)	CytK1 F: CAA TTC CAG GGG CAA GTG TC	CytK1	426
Cytotoxin K1 (Guinebretière et al. 2006)	CytK1 R: CCT CGT GCA TCT GTT TCA TGA G	CytK1	426

^aPrimers used to amplify B. cereus virulence-related genes and ITS rRNA regions, with the corresponding references; F, forward primer; R, reverse primer

ISSN: 1869-2044