Table 1 Primers used in this study
From: Acetobacter thailandicus sp. nov., for a strain isolated in Thailand
Primer | Sequence (5′ to 3′) | Bacterial species to which primer applies | Size (bp) | Source or reference |
|---|---|---|---|---|
FgroEL | CAATGGCTGCCAAAGACG | A. pasteurianus, A. orleanensis, A. lovaniensis, | 1,600 | The present study |
RgroEL | GAAGGACTTAGAAGTCCAT | A. tropicalis, A. indonesiensis, A. syzygii, | Â | The present study |
| Â | Â | A. cibinongensis, A. orientalis, A. ghanensis, | Â | Â |
| Â | Â | A. malorum, A. senegalensis, A. fabarum, | Â | Â |
| Â | Â | A. farinalis, A. okinawensis, A. papayae and | Â | Â |
A. persici | ||||
FgroELnew | CTGGACAAGAGCTTCGGC | A. cerevisiae and A. peroxydans | 1,400 | The present study |
RgroELnew | GGATAACGGCAACACCGC | A. thailandicus isolate AD25T | 1,000 | The present study |
FgroEL89 | CCGTGCGGACAACCTTGG | A. pomorum | 1,200 | The present study |
RgroEL89 | CGGCACCACAACGGCTAC | The present study | ||
FgroELcenter | GGTTGAAGAAGCCAAGCA | All species except for A. aceti, A. nitrogenifigens, A. estunensis and A. oeni | Â | The present study |
groEL-10-F | ACAAGTTCGAGAACATGGGC | A. aceti, A. nitrogenifigens, | 900 | Cleenwerck et al. (2010) |
groEL-11-R | TCCTTGCGCTCCTTCACCTC | A. estunensis and A. oeni | Cleenwerck et al. (2010) |