Table 2 Primers used in the study
From: Metabolic engineering of Saccharomyces cerevisiae for accumulating pyruvic acid
Primer | Sequence (5′ → 3′) (underlined sections indicate restriction endonuclease sites) | Design principles and requirements |
|---|---|---|
Pad1U | AATGCGGCCGCATGTCTGAAATTACTTTGG | Upstream primer of the PDC1 ORF with NotI site |
Pad1D | TAAGCGGCCGCTTAAATCGCTTATTGCTTAGC | Downstream primer of the PDC1 ORF with NotI site |
Kan1 | AATAGATCTGCTCTCCCTTATGCGACTCCTG | Upstream primer of the Kan r gene with BglII site |
Kan2 | TGGAATTCACTTGAAGTCGGACAGTGAGTG | Downstream primer of the Kan r gene with EcoRI site |
Pad5U | AATGCGGCCGCATGTCTGAAATAACCTTAGG | Upstream primer of the PDC5 ORF with NotI site |
Pad5D | TAAGCGGCCGCTTATTGTTTAGCGTTAGTAGCG | Downstream primer of the PDC5 ORF with NotI site |
His1 | ATCAAGCTTAGAATTGGTTAATTGGTTG | Upstream primer of the His4 gene with HindIII site |
His2 | TCGAATTCTAATGCGGTAGTTTATCAC | Downstream primer of the His4 gene with EcoRI site |
KanU | GTCAGCAACACCTTCTTCACGAG | Upstream primer of the PDC1 disruption cassette, part of the PDC1 sequence |
Pdc1D | GTTGATACCGAAAGCGGAGGTAC | Downstream primer of the PDC1 disruption cassette, part of the Kan r sequence |
PU1 | GCCAAGTCAACTGTAACACCG | Upstream primer of the PDC5 disruption cassette, part of the His4 sequence |
PU2 | CAGCAGCATAGGGAAACACG | Downstream primer of the PDC5 disruption cassette, part of the PDC5 sequence |