Evaluation of the extent of spreading of virulence factors and antibiotic resistance in Enterococci isolated from fermented and unfermented foods

Table 1 Polymerase chain reaction (PCR) primers used for the detection of virulence factors and random amplified polymorphic DNA (RAPD)-PCR analysis

Gene	Responsible for	Sequence	Product size (bp)	Reference
Ace	Adhesion of collagen	AAAGTAGAATTAGATCCACAC	320	Dupre et al. (2003)
Ace	Adhesion of collagen	TCTATCACATTCGGTTGCG	320	Dupre et al. (2003)
Agg	Cell aggregation and conjugation	AAGAAAAAGAAGTAGACCAAC	1553	Eaton and Gasson (2001)
Agg	Cell aggregation and conjugation	AAACGGCAAGACAAGTAAATA	1553	Eaton and Gasson (2001)
Ccf	Sex- pheromone	GGGAATTGAGTAGTGAAGAAG	543	Reviriego et al. (2005)
Ccf	Sex- pheromone	AGCCGCTAAAATCGGTAAAAT	543	Reviriego et al. (2005)
Cpd	Sex- pheromone	TGGTGGGTTATTTTTCAATTC	782	Reviriego et al. (2005)
Cpd	Sex- pheromone	TACGGCTCTGGCTTACTA	782	Reviriego et al. (2005)
efaA _fm	Antigen of bacteria endocarditis	AACAGATCCGCATGAATA	735	Eaton and Gasson (2001)
efaA _fm	Antigen of bacteria endocarditis	CATTTCATCATCTGATAGTA	735	Eaton and Gasson (2001)
Esp	Immune evasion	TTACCAAGATGGTTCTGTAGGCAC	913	Shankar et al. (1999)
Esp	Immune evasion	CCAAGTATACTTAGCATCTTTTGG	913	Shankar et al. (1999)
gelE	Hydrolysis of gelatin, collagen, haemoglobin	ACCCCGTATCATTGGTTT	419	Eaton and Gasson (2001)
gelE	Hydrolysis of gelatin, collagen, haemoglobin	ACGCATTGCTTTTCCATC	419	Eaton and Gasson (2001)
M13R2	Genotypic characterization	GGAAACAGCTATGACCATGA	Random primer	Martín et al. (2005)
CC1	Genotypic characterization	AGCAGCGTGG	Random primer	Cocconcelli et al. (1995)

ISSN: 1869-2044