Table 2 Primer sets and thermal profiles used in PCR amplification
From: A comparative study of ammonia-oxidizing archaea and bacteria in acidic and alkaline purple soils
Target group | Primer set | Sequence (5′-3′) | Thermal profile | Reference |
|---|---|---|---|---|
AOB | amoA-1 F | GGGGTTTCTACTGGTGGT | 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C,30 s at 55 °C and 1 min at 72 °C, and 5 min at 72 °C for the last cycle | Rotthauwe et al. 1997 |
amoA-2R | CCCCTCKGSAAAGCCTTCTTC | |||
AOA | Arch-amoAF | STAATGGTCTGGCTTAGACG | 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C,30 s at 53 °C and 1 min at 72 °C, and 5 min at 72 °C for the last cycle | Francis et al. 2005 |
Arch-amoAR | GCGGCCATCCATCTGTATGT | |||
cbbL | K2f | ACCAYCAAGCCSAAGCTSGG | 5 min at 94 °C, followed by 38 cycles of 30 s at 94 °C,30 s at 57 °C and 1 min at 72 °C, and 5 min at 72 °C for the last cycle | Tolli and King 2005 |
V2r | GCCTTCSAGCTTGCCSACCRC |