Biosorption of Cr(III) and Cr(VI) by Streptomyces VITSVK9 spp.

Abstract

The aim of the study was to evaluate the biosorption of heavy metals by actinomycetes isolated from marine sediment samples collected at the Bay of Bengal coast of Puducherry, India. The effect of initial metal ion concentration, pH and biomass dosage on biosorption of chromium ions was investigated. The isolate showed initial metal ion concentration of 80 and 100 mg l⁻¹ for Cr(III) and Cr(VI), respectively, pH of 4.0 for Cr(III) and 7.0 for Cr(VI) with biosorption capacity of 76 and 84.27% for Cr(III) and Cr(VI), respectively. The biosorbent dosage was optimized as 3 g l⁻¹ for both forms of chromium. The isolate showed the highest MTC (Maximum Tolerance Concentration) value of 1400 mg l⁻¹ for Cr(VI) and 2,200 mg l⁻¹ for Cr(III). The potential strain was characterized by polyphasic taxonomic approach and identified as a member of the genus Streptomyces. Based on the phenotypic and phylogenetic analysis, the strain was classified as a new species of the genus Streptomyces and designated as Streptomyces VITSVK9 sp. (HM137310). The BLAST search of 16S rDNA sequence of the strain showed highest similarity (95%) with Streptomyces sp. A515 Ydz-FQ (EU384279). The media and growth conditions were optimized for maximal growth under shake flask conditions by measuring the dry weight of mycelium. Maximal growth was seen with glucose as carbon source, peptone as nitrogen source and ammonium chloride as inorganic nitrogen. The growth of the isolate was maximal after 9 days of incubation at 35°C and pH of 7.0. Fourier transform infrared absorption spectrum results indicated that the chemical interactions between the functional groups hydroxyl (–OH), amine (–NH2), carboxyl (–COOH) and hydroxyl (–CHOH) of biomass and the metal ions. The results of our study revealed the biosorption property of metabolites produced by Streptomyces VITSVK9 spp. and this could be used as potential biosorbent for removal of heavy metal ions from aqueous environment.

Introduction

Several industrial activities including electrolytic treatment, ceramic production, fertilizer production and pigments production can create severe heavy metal pollution. The heavy metals have high mobility in aquatic systems and in general may produce high toxicity (Zouboulis et al. 2004). Due to non-biodegradability, metal ions accumulate and their amounts are increased along the food chain. Hence, their toxic effects are more pronounced in the animals at higher trophic levels. Industrialization processes and continued release of emissions adversely affect the environment leading to the destruction of many agricultural lands and water bodies, thus becoming a matter of great concern. Metals occur naturally, and several of them are essential components of global ecosystems (Pinto et al. 2003). They are present in the environment in a wide range of oxidation states and coordination numbers, and these differences are related to their toxicity. Chromium is a common and very toxic pollutant introduced into natural waters from a variety of industrial wastewaters particularly from tanneries. Chromium is widely used in many industrial operations such as chrome plating, wood preserving, textile dyeing, pigmenting, chromium chemical production, pulp and paper industries and leather tanning. The wastewater resulting from these processes contains high amounts of chromium metal, which is harmful for the environment and human health (Zayed and Terry 2003). In the last few decades, the amount of chromium in aquatic and terrestrial ecosystems has increased as a consequence of different human activities. Lead, cadmium and mercury are the major toxic metal series, and chromium can also be added in the list (Saha and Orvig 2010). Chromium exists in 11 valence states ranging from −IV to +VI (Fukai, 1967), of which only Cr(III) and Cr(VI) are significant. Hexavalent chromium compounds are approximately 1,000-fold more cytotoxic and mutagenic than trivalent chromium (Biedermann and Landolph 1990). Cr(VI) is highly water soluble and mobile, while Cr(III) shows poor solubility and is easily adsorbed on mineral surfaces. Differences in membrane transport may explain the abilities of these two speciations of chromium to induce the formation of reactive oxygen species and produce oxidative tissue damage. Cr(VI) to Cr(III) reduction, therefore, represents a significant immobilization mechanism (Bagchi et al. 2001).

Biosorption is an innovative technology that employs biological materials to accumulate heavy metals from wastewater through metabolically mediated or physicochemical pathways of uptake (Fourest and Roux 1992). Many microbes oxidize Cr(III) to Cr(VI) and reduce Cr(VI) to Cr(III) under aerobic and anaerobic conditions (Jeyasingh and Philip, 2005). Cr(III) is toxic to fish when its concentration in water exceeds 5 mg l⁻¹ (Alloway and Ayres 1997). Cr(III) is an active allergic agent, and is also induced by Cr(VI) exposure. Kidney damage in long-term exposure of Cr(III) is of great concern. Cr(III) species normally carry a positive charge and therefore can be easily adsorbed on the negatively charged soil particles (Silva et al. 2008; Deng et al. 2006). This leads to pollution of the soil environment thereby entering the food chain.

Metal bioaccumulation by marine organisms has been the subject of considerable interest in recent years because of serious concern that high levels of metals may have detrimental effects on the marine organisms and may affect marine food and through them affect humans (El-Moselhy and Gabal 2004). Algae, bacteria and fungi have proved to be potential metal biosorbents (Volesky 1986). Generally, microorganisms interact with toxic metals by three processes including biosorption, bioaccumulation and enzymatical reduction. Actinomycetes constitute a significant component of the microbial population in most soils. Their metabolic diversity and particular growth characteristics, mycelial form and relatively rapid colonization of selective substrates indicate them as well suited to be agents for bioremediation of metal and organic compounds. However, there are very few studies on Cr(VI) resistance and bioreduction by actinomycetes. Amoroso et al. (1998) have reported that metal resistance and biosorption capability may be widespread among actinomycetes growing in contaminated environments. Richards et al. (2002) have studied the heavy-metal resistance patterns of Frankia strains. The first report on Cr(VI) reduction by Streptomyces was from Das and Chandra (1990). Later, Amoroso et al. (2001) reported Cr(VI) bioaccumulation by Streptomyces strains. Cr(VI) reduction by Streptomyces griseus was reported by Laxman and More (2002). The aim of the present study is to determine the Cr(III) and Cr(VI) resistance and removal by actinomycetes strains isolated from marine sediments collected at the Bay of Bengal coast of Puducherry and Marakkanam, Tamil Nadu, India.

Materials and methods

Strain isolation

Marine sediment samples (total 21) waere collected from Puducherry (11°56′N, 79°53′E) on the coast of the Bay of Bengal, India, at depths of 50–300 cm using a large sterile spatula. The sediments collected in sterile containers (covered with aluminium sheet) were maintained at ambient temperature with seawater and transported to the laboratory. The sediment samples were dried in laminar air flow for 8–12 h and then kept at 42°C for 10–30 days in a sterile Petri dish, and these preheated samples were used for isolation of actinomycetes. Collected samples were serially diluted and inoculated onto three culturing media, the International Streptomyces Project (ISP) No. 1 (Shirling and Gottlieb 1966), Starch casein agar (1% soluble starch, 0.1% casein, 0.05% KH₂PO₄, 0.05% MgSO₄, 3% NaCl, 2% agar) and Kuster’s agar medium (1% glycerol, 0.003% casein, 0.02% KNO₃, 0.02% KH₂PO₄, 0.02% NaCl, 0.005% MgSO₄, 0.002% CaCO₃, 0.001% FeSO₄, 2% agar) (prepared with 25% sea water and 25% soil extract) for the isolation of actinomycetes (Kumar and Kannabiran 2010a). The medium was amended with 100 mg l⁻¹ of chromium in the form of K₂Cr₂O₇ for Cr(VI) at pH 6.5 and Cr(NO₃)₃·9H₂O for Cr(III) at pH 3.5 and incubated at 30°C for 4–6 days under shaking (150 rpm) to enrich the chromium-tolerant actinobacterial populations, and the growth media were supplemented with the antibiotics cycloheximide (25 mg ml⁻¹) and nalidixic acid (25 mg ml⁻¹) (Himedia, India). The soil extract was prepared by mixing 400 g of sediments with 1,000 ml of distilled water and centrifuged. The supernatant was filtered through 0.45-μm membrane filters (Millipore, India). The clear supernatant obtained was adjusted to a pH of 7–9 and used as a soil extract. The colonies were recognized according to their cultural and biochemical characteristics and then transferred to slant culture at 4°C as well as at 20% (v/v) glycerol stock at –80°C.

Physicochemical properties and trace metal detection

The physicochemical properties of sediments were analyzed and recorded. The physicochemical parameters such as pH, electrical conductivity, nitrogen, phosphorus, potassium, soil texture, lime status, ferrous, manganese, zinc and copper (Jackson 1973; Lindsay and Norwell 1978) were determined. The collected sediment samples were also processed and analyzed for trace metal concentration. The estimation was done using Atomic Absorption Spectrophotometer (AAS) with Graphite Furnace, Inductively Coupled Plasma-Optical Emission Spectrophotometer (ICP-OES) and also by the colorimetric method.

Evaluation of tolerance to Cr(III) and Cr(VI)

The maximum tolerance concentration (MTC) for the selectively isolated strains were determined by the well diffusion and broth dilution methods in ISP No.1 medium with Cr(III) and Cr(VI) concentrations ranging from 100 to 4,000 mg l⁻¹. The maximum concentration of chromium in which the bacterial growth was found has been recorded as the MTC value of those bacteria.

Characterization and optimization of nutritional and culturing conditions of resistant strain

The morphological and biochemical characterization of the resistant isolate was carried out as described in International Streptomyces project (ISP). Antibiotic susceptibility test for the isolate was performed using disc diffusion assay, where different antibiotics discs were used at a concentration of 10 μg/ml. The morphology of the spore-bearing hyphae with the entire spore chain, substrate and aerial mycelium of the strain was examined by light microscope as well as by scanning electron microscope (Hitachi, S 3400 N). To determine the optimal nutritional and cultural conditions and to identify the suitable media for growth, the isolate was inoculated in different culture media (SCA, ISP #1, ISP #2, ISP #3, ISP #4, ISP #5, ISP #6, ISP #7 and Kuster’s agar) and the growth was investigated by determining the weight of the biomass (Shirling and Gottlieb 1966; Kumar and Kannabiran 2010b). Different nutritional amendments (carbon, nitrogen, amino acid amendents and NaCl concentration) and culturing conditions (incubation temperature, pH and incubation time) were optimized for the maximal growth of the strain by inoculating it in basal medium with variable amounts.

Isolation of chromosomal DNA

Culture broth (1.5 ml) was taken in a sterile microfuge tube and vortexed for 20 s. The broth was centrifuged at 8,000 rpm for 5 min at room temperature and the supernatant was discarded. The process was repeated to get enough cell mass. The genomic DNA was isolated using a modified version of the procedure of Kutchma et al. (1998) and purified by phenol/chloroform extraction. DNA concentration was evaluating using 0.8% (w/v) agarose gel electrophoresis stained with ethidium bromide and then visualized using a Image Analyzer Gel Doc 2000 (Bio-Rad Laboratories, Hercules, CA, USA). Lambda DNA was used as control.

PCR amplification of the 16S rDNA

The sequencing templates of 16S ribosomal DNA (rDNA) was amplified from genomic DNA by PCR as described previously (Stach et al. 2003). Actinomycete-specific primers FC27 (AGAGTTTGATCCTGGCTCAG) and RC1492 (TACGGCTACCTTGTTACGACTT) were used. All sequencing reactions were carried out with an ABI PRISM 377TM DNA sequencer at the Invitrogen laboratory, Bangalore, India. The 16S rDNA sequences obtained were used to search the GenBank database by using BlastN algorithm to identify the closest matches among the known species. Sequences were aligned with representative actinomycetes 16S rDNA sequences and a phylogenetic tree was constructed using the Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0 (Kumar et al. 2001).

Biosorption experiments

Biosorption experiments were carried out at different pH values (3.0, 4.0, 5.0 and 6.0), varying initial metal ion concentration (10–100 mg l⁻¹) and different biomass dosage to optimize the biosorption efficiency. A fully-grown culture was centrifuged and different weights of the biomass ranging from 0.5 to 3.0 g obtained. This biomass of varying weight from Streptomyces strain was used for removal of Cr(III) and Cr(VI) ions and was optimized. A stoppard conical flask (100 ml) containing 25 ml of varying metal ion solution with appropriate biomass concentration and pH was kept for shaking in an electrically thermostatic reciprocating shaker at 100 rpm for 1 week. The contents of the flask were filtered through filter paper and the filtrate was analyzed for metal concentration by using a flame atomic absorption spectrophotometer (Kumar and Kannabiran 2011). The percentage biosorption of metal ions was calculated as follows:

$$ {\hbox{Biosorption}}\,\left( \% \right) = \frac{{\left( {C{\text{i}} - C{\text{f}}} \right)}}{{C{\hbox{i}}}}\, \times \,{1}00 $$

Ci and Cf are the initial and final metal ion concentrations, respectively.

FT-IR analysis

In order to investigate the involvement of various functional groups in biosorption of metals and possible metal binding sites of functional groups present in the biomass of the isolate, infrared spectra of Cr(III) and Cr(VI) loaded and metal non-loaded samples were obtained using a Fourier transform infrared spectrometer (FT/IR-AVATAR 330).

Statistical Analysis

All the experiments were performed in triplicate and the data obtained were expressed as mean ± standard error. One-way ANOVA was used to calculate significant differences between the samples at a confidence level of a = 0.05. All the statistical analysis was done using Graph Pad Prism software version 5.02.

Results and discussion

Physicochemical properties and trace metal detection

The analysis of physiochemical properties of sediments showed insignificant variation in dissolved oxygen, nitrate nitrogen, total phosphate and dissolved organic phosphate with significant variation in total hardness (Ca⁺⁺ and Mg), pH, salinity and temperature for the observed period.

Analysis of sediments for trace metal concentration showed the presence of lead as 13 ± 2.1 μg l⁻¹, chromium as 7.4 ± 0.8 μg l⁻¹, cadmium as 3.1 ± 0.3 μg l⁻¹, zinc as 8.4 ± 2.6 μg l⁻¹ and copper as 0.3 ± 0.1 μg l⁻¹ , whereas mercury was below the detection limit. All the samples was found to be statistically significant at p < 0.05. The results showed the high percentage of lead in the sediment, well above the permissible limit. A prolonged exposure to heavy metals exerts a highly selective pressure on the microbial community, which could lead to the appearance of metal-resistant strains (Saxena and Bhattacharya 2006). These results indicate that the adaptation might be a common phenomenon of environmental isolates that could occur when the environment is contaminated with higher concentrations of pollutants.

Strain isolation and tolerance to chromium

The selective isolation process resulted in the isolation of 94 actinomycetes strains from 21 sediment samples. Different medias were used for the selective isolation of the actinomycetes with the preheated sediment samples and the use of metal solution in the medium resulted in the isolation of a metal-tolerant Streptomyces species. MTC for the isolates were estimated based on their growth on various concentration of chromium ranging from 100 to 4,000 mg l⁻¹ amended in ISP No.1 medium by agar diffusion and broth dilution methods. The majority of the isolates showed the MTC range of 100–500 mg l⁻¹ to Cr(VI) and Cr(III). The highest MTC value found for the strain VITSVK9 was 1,400 mg l⁻¹ for Cr(VI) and 2,200 mg l⁻¹ for Cr(III). Ksheminska et al. (2005) have reported that the tolerance of yeast was up to 5 mM concentration of Cr(III). Our results were found to be in accordance with Amoroso et al. (2001) who has isolated two Streptomyces strains, able to grow up to 2 mM Cr(VI) concentration in MM agar medium with efficient Cr(VI) biosorption capability. Similar Cr(VI) biosorption value was reported with Bacillus sp. (Nurbap Nourbakhsh et al. 2002).

Characterisation and optimization of nutritional and culturing conditions of resistant strain

The biochemical, morphological and cultural characteristics of the strain revealed that the strain is a Gram-positive, non-acid fast, non-motile, aerobic actinomycetes. The susceptibility of the isolate to various antibiotics was checked by the disc diffusion technique and the strain VITSVK9 was sensitive to cefixime and neomycin but resistant to ciprofloxacin, gentamycin, tetracycline and penicillin G (Table 1). The aerial mycelium of the strain was branched, white in color and the substrate mycelium was also branched and produced a powdery colony on optimized medium and optimized culturing conditions. But both the aerial and substrate mycelium were found to be medium dependent. A long chain of spores were oval to cylindrical in shape, arranged in long chains and each contained more than 10–25 spores. The mature spores were 0.5–1.0 mm in diameter and the length was between 0.8 and 1.0 mm (Fig. 1). Spacial morphology such as sporangia and sclerotia was not observed. Scanning electron microscopy revealed the presence of spiral arrangement of spores which confirmed that isolate belongs to the genus Streptomyces.

Table 1 Biochemical characteristics of Streptomyces VITSVK9 spp.

Fig. 1

Scanning electron micrograph of Streptomyces VITSVK9 spp. grown in optimized medium at 30°C for 9 days; bar 10 μm

Cultural characteristics and media composition were optimized by a systematic study and the suitabilities of various carbon and nitrogen sources were evaluated and correlated. Optimization for the growth of VITSVK9 isolate was carried out in batch culture. The strain was cultured on the basal medium with different parameters and their effect on the growth was studied in terms of their biomass. Strains were capable of growing on all the media used. However, VITSVK9 showed the highest biomass (6.86 ± 0.23 mg ml⁻¹) when grown onto ISP No. 1 medium. Concentration of glucose in the medium influenced the growth of the isolate. Glucose at 1% (w/v) provided the highest growth (4.9 ± 0.46 mg ml⁻¹) for the strain when used as carbon source. In contrast, growth was decreased with either increase or decrease of glucose concentration. High concentration of glucose is generally considered as repressor of secondary metabolisms (Demain 1989) and maximum cell growth rates can inhibit antimicrobial agent production (Gallo and Katz 1972). Of all the nitrogen sources tested, maximal growth (6.86 ± 0.23 mg ml⁻¹) was seen with peptone. Among inorganic nitrogen sources, ammonium chloride showed a moderate effect on the growth of the isolate. It is clear from the results that the growth was greatly influenced by the nature and type of the nitrogen source supplied in the culture medium. The optimized nutritional and culturing conditions for the growth by the strain VITSVK9 are presented in Table 2.

Table 2 Optimal nutritional and culturing conditions for the growth of Streptomyces VITSVK9 spp.

Phylogenetic analyses

The partial sequencing of 16S rRNA gene of the strain VITSVK9 on both directions yielded 16S rDNA nucleotide sequence with 1,532 base pairs. The 16S rDNA sequence of the strain was deposited in the GenBank (NCBI, USA) under the accession number HM137310. The BLAST search of 16S rDNA sequence of the strain showed highest similarity (95%) with Streptomyces sp. A515 Ydz-FQ (EU384279). A neighbor-joining tree based on 16S rDNA sequences showed that the isolate occupies a distinct phylogenetic position within the radiation including representatives of the Streptomycetes family (Fig. 2). The phylogenetic tree based on the maximum-parsimony method also showed that the isolate forms a separate clade. Based on the molecular taxonomy and phylogeny, the strain was identified as Streptomyces species and designated as Streptomyces VITSVK9 spp.

Fig. 2

The phylogram showing the position of the strain VITSVK9 with other Streptomyces species based on 16S rDNA sequence. Phylogenetic tree based on neighbor-joining analysis of 1,000 replicated data. Numbers at nodes indicates the percent level of bootstrap support. Score bar 1 nucleotide substitution per 100 nucleotides. Bootstrap values of 50 and above are shown

Effect of wet biomass dosage on biosorption

Initially, a highest metal ion concentration of 100 mg l⁻¹ was taken for the biosorption experiment. The biosorption efficiency for Cr(III) and Cr(VI) ions as a function of biomass dosage showed that the biosorption efficacy increased gradually with increase in biosorbent concentration (0.5 to 3 g l⁻¹) (Fig. 3). The maximum biosorption was found to be 83.24% for Cr(III) and 71.24% for Cr(VI) at the biomass dosage of 3 g l⁻¹. The optimum condition identified for one parameter was used for optimizing other parameters one by one. Earlier studies of Yao and Ye (2009) and Acharya et al. (2009) have indicated that the biosorbent dose was also an important parameter affecting biosorption capacity as well as removal efficiency.

Fig. 3

Effect of biomass dosage on biosorption of Cr(III) and Cr(VI) by Streptomyces VITSVK9 spp. biomass

Effect of initial metal ion concentration on biosorption

The initial metal ion concentration remarkably influenced the percentage metal biosorption (Fig. 4). The initial Cr(III) concentration increased from 10 to 100 mg l⁻¹, the biosorption capacity increased to 80 mg l⁻¹, but the biosorption ability drastically decreased thereafter with increase of metal ion concentration. On the other hand, the biosorption capability for Cr(VI) was found to be at a maximum at 100 mg l⁻¹ metal ion concentration. For Cr(VI), the biosorption ability increased with the increase of metal ion concentration. The higher biosorption ability with increased metal ion concentration could be attributed to higher probability of interaction between metal ions and biosorbents.

Fig. 4

Effect of metal ion concentration on biosorption of Cr(III) and Cr(VI) by Streptomyces VITSVK9 spp. biomass (3 g l⁻¹)

Effect of pH on biosorption

The effect of pH on the uptake of Cr(III) and Cr(VI) ions by Streptomyces VITSVK9 spp. is shown in the Fig. 5. The maximum uptake of Cr(III) was observed at pH 4.0, and Cr(VI) ion at 7.0. At higher pH values, the biosorption was dramatically decreased. The increased biosorption at pH 4.0 may be due to more of negatively charged groups in biomass surface capable of binding positively charged metal ions. Decrease in biosorption at higher pH (pH > 4) is may be due to the formation of soluble hydroxylated complexes of the metal ions and their competition with the active sites, and as a consequence, the retention would decrease. The metal-binding properties of Gram-positive bacteria, such as actinomycetes (Streptomyces), are largely due to the existence of specific anionic polymers in the cell wall structure, consisting mainly of peptidoglycan, teichoic or teichuronic acids (Yee et al. 2004). Earlier studies on heavy metal biosorption have shown that pH was the single most important parameter affecting the biosorption process (Aksu et al. 1991; Donmez et al. 1999).

Fig. 5

Effect of pH on biosorption of Cr(III) and Cr(VI) by Streptomyces VITSVK9 spp. biomass

The biosorption of Cr(III) was studied by Prigione et al. (2009) with 5 different fungal species; maximum removal observed was 38% from real tanning effluents. Bioaccumulation of Cr(III) was studied in yeast (Kaszycki et al. 2004), lichens (Ksheminska et al. 2005), and in Parmelina tiliaceae (Uluozlu et al. 2008). But not much reports are available on Cr(III) bioaccumulation by bacteria. Different types of pure and mixed microbial cultures isolated from chromium-polluted areas have been investigated for their ability to bioaccumulate chromium (VI) (Zouboulis et al. 2004; Srinath et al. 2002; Badar et al. 2000; Saxena et al. 2001). Metal bioremoval by living cells include two processes, one is active metabolism in which metals accumulate inside the cell, and another of passive metabolism in which metals adhere to surface molecules such as the S-layer proteins (Velásquez and Dussan 2009). If an adsorption process is taking place, surface molecules such as the S-layer proteins can have a saturation level in which no more metallic ions can adhere. If the process is metal accumulation, an efflux mechanism can be functioning up to certain metal concentration preventing more metal accumulation. Similar processes have been reported with Pseudomonas aeruginosa and Cupriavidus metallidurans by Ramírez et al. (2008).

FT-IR analysis

The possible interactions between the functional groups of Streptomyces VITSVK9 spp. biomass with chromium were evaluated by FT-IR spectroscopy. The FTIR spectra of lyophilized native culture biomass are shown in Fig. 6a. The broad band spectra at 3,150 cm⁻¹ was due to bounded hydroxyl (–OH) or amine (–NH2) groups in the native culture. This band was slightly shifted to 3,123 cm⁻¹ in Cr(III)-treated culture (Fig. 6b). The peaks observed between 1,623 and 1,638 cm⁻¹ were attributed to stretching vibration of C = C group. The Cr(III)-treated Streptomyces VITSVK9 spp. showed the presence of polysaccharides which were indicated by peaks in the range of 1,020 cm⁻¹. The FTIR spectra of lyophilized Cr(VI- loaded cell biomass are shown in Fig. 6c. The band at 3,150 cm⁻¹ in native culture was slightly shifted to 3,122 cm⁻¹ in Cr(VI- treated Streptomyces VITSVK9 spp. The peaks observed between 1,623 and 1,638 cm⁻¹ were attributed to stretching vibration of C = C group. This might be due to the secretion of high molecular mass polymers, which can either be released into the environment or remain attached to cell surfaces. The extensive heavy metal binding capacities of polysaccharides are recommended as a surface-active decontamination agent.

Fig. 6

Fourier transform infrared absorption spectrum of biosorption of Cr(III) and Cr(VI) by Streptomyces VITSVK9 spp. a Native biomass of Streptomyces VITSVK9 spp. b Cr(III)-treated biomass (3 g l⁻¹) of Streptomyces VITSVK9 spp., and c Cr(VI)-treated biomass (3 g l⁻¹) of Streptomyces VITSVK9 spp.

The microbial cell wall is known to be rich in polysaccharides and glycoproteins such as glucans, chitin, mannans and phospho-mannans. These polymers form abundant sources of metal binding ligands. The cell wall of Streptomyces generally contains three components, namely peptidoglycan, teichoic acid and surface protein. These compounds may contain several functional groups, such as amino, carboxyl, sulphate, hydroxyl, etc., which could play an important role in the biosorption of metal ions. The biosorption of metal ions by microbial biomass has several advantages over other conventional methods used to remove heavy metals. It has been reported that metabolism-independent metal binding to the cell walls and external surfaces is the only mechanism present in the case of non-living biomass (Ahluwalia and Goyal 2003). FTIR spectroscopy was also more often used to study the biosorption of metal ions (Ahluwalia and Goyal 2005). Bacteria may uptake and accumulate a significant amount of metal ions, resulting in transfer of metals to a contaminated matrix of biomass (Smith et al. 1994). The removal of chromium, cadmium and copper from dilute aqueous solution using dead polysaccharide-producing Ochrobactrum anthropi isolated from activated sludge has already been reported (Ozdemir et al. 2003).

Conclusion

Based on results of this study, the wet biomass and aqueous solution of Streptomyces VITSVK9 spp. exhibited concentration- and pH-dependent biosorption of heavy metal ions Cr(III) and Cr(VI).