Detoxification of enterotoxigenic Bacillus cereus (JX455159) isolated from meat by a local strain of Lactobacillus plantarum (JX282192)

Abstract

Raw minced meat samples (25) were randomly collected from different slaughterhouses in Dakhlia and Sharkyia Governorates, Egypt. One hundred and fifty Bacillus species related to the cereus group were isolated from the collected meat samples using Mannitol Yolk Polymyxin (MYP) agar plates. Purified bacterial cultures were then tested for their virulence factors with respect to hemolysin, protease and lecithinase. Of the tested Bacillus strains (150), 81, 95.3 and 76 % of total tested Bacillus strains were positive for hemolysin, protease and lecithinase tests, respectively. The identity of one of the most potent strains suspected and encoded as Bacillus cereus F23 was confirmed by amplifying its 16S rRNA gene. The partial nucleotide sequence of the amplified 16S rRNA gene of the tested strain was submitted to GenBank with accession number JX455159. Multiplex PCR amplification of enterotoxin genes in the tested strain, using specific primers, yielded amplicons of molecular sizes 695 and 565 bp for enterotoxins hblC and cytK, respectively. Thermal resistance of B. cereus F23 (JX455159) spores was determined by calculating D values at 65, 75, 85 and 95 °C for 36, 25, 19 and 16 min, respectively, and the calculated Z value was recorded as 0.119 °C. A lactic acid bacteria (LAB) strain isolated from pickles was preliminary identified as Lactobacillus plantarum F14 (LBF14) and later confirmed by detecting its 16S rRNA gene, and it was submitted to GenBank with accession number JX282192. The identified LAB strain was tested as a bioprotective agent against toxigenic B. cereus F23 spores both in minced meat samples and BHI broth medium. A reduction in B. cereus F23 population between 4 and 6 log cycles under different tested conditions was recorded. The activity of virulence factors (protease and lecithinase) decreased and hemolytic activity was completely inhibited in the presence of 10³ CFU/ml of Lactobacillus plantarum F14 (JX282192). Inthe presence of 10⁵ CFU/ml Lactobacillus plantarum F14 (JX282192), protease and lecithinase activities of B. cereus F23 were decreased by 85 and 71 %, respectively.

Introduction

The basis of the mechanism of virulence and function of the virulent factors of pathogenic bacteria are secretory proteins such as toxins and enzymes (Wu et al. 2008).

Meat is a nutritious, protein-rich food which is highly perishable and has a short shelf-life unless preservation methods are used (Hassan et al. 2006; Olaoye and Onilude 2010). Shelf-life and maintenance of meat quality are influenced by a number of interrelated factors including holding temperature, which can result in detrimental changes in the quality attributes of meat. During the slaughtering process, the meat is exposed to many sources of contamination (Jo et al. 2004; Uzeh et al. 2006). The hygienic state of animals prior, during and after slaughter can be critical to the finished product quality (Satin 2002). Bacillus cereus is one of the organisms that cause problems to the food industry both by deteriorating the products (Eneroth et al. 2001) and by endangering people’s health upon consuming contaminated foods (Ghelardi et al. 2002). Under certain conditions, strains of this species produce hemolysins, phospholipases C, and also emetic toxins and enterotoxins that causes food poisoning (Agata et al. 2002, Hassan et al. 2010).

Among the many potential virulence factors of B. cereus, hemolysis BL (HBL) is a unique and potent three-component pore-forming toxin consisting of three distinct proteins, namely the binding component (B) and lytic components (L1 and L2) (Beecher and Wong 1994).

Several food-borne pathogens such as B. cereus with special focus on the enterotoxin gene can be detected simultaneously in one-step by multiplex PCR (Guinebretiere et al. 2006; Ngamwongsatit et al. 2008). PCR-based techniques offer a sensitive and specific detection of pathogens and can also discriminate virulent bacteria from non-virulent members of the species (Olsen 2000). These methods demonstrate the potential for practical everyday use in food microbiology.

Endospore-forming bacteria such as B. cereus represent one of the highest risks and capacities to produce food-poisoning toxins in low-acid foods due to heat resistance of endospores and the broad temperature range in which some strains can grow. Food poisoning resulting from ingesting heat-stable enterotoxins produced by B. cereus is frequently a high risk. Spores surviving cooking heat treatments may germinate and reach high cell concentrations in the food (Nichols et al. 1999). Curtis (2007) reported that the growth temperature range for B. cereus is around 7 °C up to 55 °C. Agata et al. (2002) revealed that the strains of B. cereus were capable of producing hemolysins, phospholipases C, and also emetic toxins and enterotoxins under conditions that cause food poisoning.

Only heat treatments used for canning of low-acid foods will ensure a complete destruction of spores of B. cereus. Rapid cooling is necessary to prevent germination and growth of B. cereus spores (EFSA 2005). Heat resistance of microorganisms is expressed in D and Z values (Heldman and Singh 2001).

Research findings have suggested that there is increasing attention on the use of naturally occurring metabolites produced by selected lactic acid bacteria (LAB) to inhibit the growth of spoilage microorganisms (Olaoye 2010; Olaoye and Dodd 2010). These authors have demonstrated the potential of LAB cultures as biopreservatives during the processing and preservation of many forms of meat products. Lactic acid bacteria growing naturally in foods, producing antimicrobial substances such as lactic and acetic acids, diacetyl, hydrogen peroxide and bacteriocins (Olivera et al. 2008, 2010). The use of LAB as biological preservatives on meat products could confer health benefits to consumers. A comprehensive note has been reported by Olaoye and Idowu (2010) on the various features and properties of LAB used as biological preservatives of meat processing. Because of this, LAB cultures could function as probiotics, which are non-pathogenic microorganisms that, when ingested in certain numbers, exert a positive influence on host physiology and health beyond inherent general nutrition. So, this study aimed to improve the quality of raw minced meat by reducing and inhibiting enterotoxigenic B. cereus and its virulent factors using lactic acid bacteria.

Materials and methods

Food samples

Twenty-five samples of raw minced meat were collected randomly from slaughterhouses in Dakhlia and Sharkyia Governorates, Egypt, for isolation of bacilli related to the cereus group. LAB strains were isolated from pickles, meat and luncheon meat samples collected from the market in Dakhlia and Sharkyia Governorates. Food samples were placed in sterile plastic bags and transferred directly to the bacteriology laboratory located in the Botany and Microbiology Department at the Faculty of Science, Zagazig University.

Microbiological analysis

Isolation of spore-forming bacilli from collected meat samples

Spore-forming bacilli were isolated from the collected meat samples after being heated at 80 °C for 15 min for killing vegetative cells according to Olutiola et al. (1991). Decimal dilutions were prepared and bacteria related to the cereus group (red colonies) were isolated by surface spread technique on Mannitol Yolk Polymyxin (MYP) agar plates. Growing red colonies were then purified and preliminarily identified according to the key of Bergey’s Manual of Systematic Bacteriology (Holt et al. 1994).

Isolation of lactic acid bacteria (LAB) from different food samples

LAB were isolated from different food samples using surface spread technique on Man Rogosa and Sharpe agar (MRS) plates according to Sukhare and Narasimha (2003).

Identification of bacteria

Suspected colonies of B. cereus and LAB growing on MYP and MRS, respectively, were picked, purified and identified according to procedures recommended by FDA (2001) using Bergey’s Manual of Systematic Bacteriology (Holt et al. 1994) and Todar (2005).

16S rRNA gene sequencing

Total DNA was extracted from both tested bacterial isolates according to Sambrook and Russel (2001). The gene coding for 16S rRNA was amplified from each tested isolate by PCR with universal primers (forward primer [F27] 5′-AGAGTTTGATCCTGGCTCAG-3′ and reverse primer [R1492] 5′-GGTTACCTTGTTACGACTT-3′) (Turner et al. 1999; Chénbey et al. 2000). Molecular size of amplified fragments should be approximately 1,500 bp. The amplification conditions were as follows: 94 °C for 10 min and 35 cycles of denaturation at 95 °C for 30 s, annealing-extension at 56 °C for 1 min, 72 °C for 1 min and an extension at 72 °C for 10 min. Presence and yield of specific PCR products (16S rRNA gene) were monitored by running 1 % agarose gels. Then, the PCR product was cleaned up by using GeneJET™ PCR Purification Kit (Fermentas, Germany).

Amplified DNA fragments were partially sequenced at GATC Biotech (Konstanz, Germany) using ABI 3730xl DNA sequencer using forward primer (F27). The 16S rDNA sequences which have been determined in the present study were deposited at the NCBI web server (www.ncbi.nlm.nih.gov). Sequence analysis and comparisons with published sequences made using the BLAST program (http://www.ncbi.nlm.nih.gov/blast) (Altschul et al. 1997).

Determination of virulence factors

The purified Bacillus cereus strains were screened for their capability to produce specific virulence factors, namely, hemolysin, protease and lecithinase enzymes on blood agar, casein agar and egg yolk agar media, respectively, at 35 °C for 24 h using an agar well diffusion assay according to Reinheimer et al. (1990) and Misra and Kuila (1992).

Multiplex PCR of B. cereus F23 enterotoxin genes

DNA templates of the tested bacterial culture were prepared from 24-h cultures in tryptone soya broth (TSB) at 30 °C, according to the method described by Ngamwongsatit et al. (2008). Specific multiplex PCR amplification conditions for B. cereus F23 enterotoxin genes hblC and cytK were according to Ngamwongsatit et al. (2008), using two pairs of primers (FHblC: CCTATCAATACTCTCGCAA and RHblC: TTTCCTTTGTTATACGCTGC; FCytK: CGACGTCACAAGTTGTAACA and R2CytK: CGTGTGTAAATACCCCAGTT) to give product sizes 695 and 565 bp, respectively. The multiplex PCR amplification was performed in a final volume of 20 μl containing 5 μl of DNA template in a final concentration 1× PCR buffer (10 mM Tris–HCl, 2,000 μM of each dNTP, 5 U Taq DNA polymerase , 0.4 μM hblC primer, and 0.2 μM cytK primer (Abdou et al. 2011) (Table 1).

Table 1 Primers used for multiplex PCR amplification of Bacillus cereus F23 enterotoxin genes

The amplification consisted of an initial denaturation at 95 °C for 5 min, followed by 30 cycles of 94 °C for 45 s. annealing at 54 and 56 °C for 1 min for hblC and at 58 °C for cytK, and elongation at 72 °C for 2 min, with a final extension at 72 °C for 5 min. Amplicons were separated in a 1.5 % agarose gel and sizes were estimated using a 100-bp DNA Ladder (Amersham Pharmacia Biotech) run on the same gel. The amplifications were carried out in a GeneAmp PCR System 9700 Thermal Cycler (PE Applied Biosystems, Norwalk, CT, USA). Primers used in this study were synthesized by Metabion International (Martinsried, Germany).

The thermal resistance of B. cereus F23 spores expressed in terms of D and Z values

Heat resistance of tested Bacillus strain was measured according to Yamazaki et al. (1997). Thermal exposure of tested strain were done at 65, 75, 85, and 95 °C for 0, 5, 10, 15, 20, 25, 30, 35, and 40 min, then immediately cooled with tap water. Plate count technique was achieved with MYP agar growth medium at 37 °C for 24 h.

The D value was determined by plotting a survival curve between thermal exposure time versus logarithm value of bacterial count. The Z value was determined by plotting thermal temperature (°C) against D values as an ordinate (Heldman and Singh 2001).

Antimicrobial activity assay of LAB strains

The isolated LAB strains were grown in MRS broth (pH 6.5) which was inoculated with 1 % overnight culture of the isolated LAB strain and incubated at 37 °C for 18–24 h. After incubation, the cells were removed from the growth medium by centrifugation (6,000g for 20 min, 4 °C). The cell-free supernatant was sterilized by filtering through a 0.22-μm Millipore filter.

The antimicrobial spectrum of the cell-free supernatant of different LAB strains was determined using the disc diffusion method according to Tagg and McGiven (1971). The toxigenic bacteria were cultured on nutrient agar for 24 h at 37 °C, and used to prepare cell suspensions in 9 ml normal saline. Twenty ml of brain heart infusion (BHI) agar cooled to 45 °C was mixed with 110 μl of the toxigenic strain suspension, pooled in a Petri dish, and incubated aerobically for 2 to 4 h at 37 °C. Six-mm paper discs saturated with 100 μl of the supernatants were placed on surface of seeded BHI agar plates and incubated at 37 °C for 24 h. Inhibition zones were determined by measuring the diameter of the clear zones around the well, in mm.

Antagonistic effect of Lactobacillus plantarum F14 (LB14) against B. cereus F23 strain in meat samples

Nine g of meat sample in 9 ml aliquot of brain heart infusion (BHI) were inoculated with 1 ml of toxigenic B. cereus F23 (10⁶ CFU/ml) and shaken vigorously, then inoculated with different inoculum sizes of LB14 (10³, 10⁴, 10⁵ and 10⁶ CFU/ml) at a wide range of temperatures (8 up to 55 °C) for different incubation periods (6, 12, 18, 24, 30, 36, and 48 h).

Effect of Lactobacillus plantarum F14 on virulence of B. cereus F23

The BHI broth media were inoculated with 10⁵ CFU/ml of B. cereus F23 together with different inoculum sizes of LB14 strain and incubated at 37 °C for 24 h. Thereafter, mixed cultures were filtrated and examined for their capability of producing virulence factors (hemolysin, protease and lecithinase) of B. cereus F23 as previously described.

Results and discussion

The hygienic status of animals prior, during and after slaughter can be critical to the finished product quality (Abostate et al. 2006). Spoilage of meat has remained a serious challenge in developing countries for decades. This has been due to poor storage systems in such countries where necessary facilities that could help promote preservation are unavailable. The ambient temperature in developing countries that are in tropical regions is usually about 30 °C or above; most spoilage organisms have been found to have their optimum growth temperature within such a range (Olaoye and Ntuen 2011). In the present investigation, a general appraisal of the prevalence of toxigenic B. cereus strains in meat and the potential of lactic acid bacteria in its biopreservation were discussed.

High prevalence of virulent strains of Bacillus species in the collected raw meat samples was observed in the present study. Eighty-five and sixty-five strains were isolated from 30 meat samples, collected from slaughterhouses in Dakahlia and Sharkyia governorates, respectively. The presumptive isolates (cereus group) with red colonies on MYP agar were purified and further studied.

Virulence of isolated bacilli was screened by testing their capability to produce hemolysin, protease and lecithinase enzymes on blood agar, casein agar and egg yolk agar media, respectively. About 95.3 % of tested isolates showed positive protease activity while 81 % caused blood hemolysis and 76 % produced lecithinase enzyme (Table 2). The results are in agreement with Guven et al. (2006), who reported a high percentage (86.6 %) of isolates from the cereus group able to produce hemolytic toxin in culture media. Jo et al. (2004) declared that during the slaughtering process the meat was exposed to many sources of B. cereus contamination.

Table 2 Prevalence (cereus group) and virulence of spore-forming Bacillus spp. in minced meat samples isolated on MYP agar

Several studies have previously reported that B. cereus is one of the potential food-borne toxigenic bacteria associated with red meat (Nel et al. 2004; Schneider et al. 2004; Abostate et al. 2006). Fifteen Bacillus isolates (10 %) exhibiting highest virulent activities (data not shown) were preliminarily identified as Bacillus cereus depending on morphological and biochemical characteristics described in Bergey’s Manual (Holt et al. 1994) and selected for further studies.

Virulence capacity of the 15 identified B. cereus strains were studied at a wide temperature range from 8 °C up to 55 °C (Table 3) and strain B. cereus 23 was selected as the most virulent strain at different temperatures. PCR amplification of 16S rRNA gene confirmed the identity (95 %) of the selected potent strain as B. cereus. The partial nucleotide sequence of the amplified gene was submitted to GenBank (http://www.ncbi.nlm.nih.gov/GenBank/update.htm) under accession number JX455159.

Table 3 Detection of virulence factors of the most virulent strain at a wide range of temperatures (8 °C up to 55 °C) for 24 h

Specific multiplex PCR amplification conditions were used to detect the presence of enterotoxins genes hblC and cytK in B. cereus F23. Agarose gel revealed molecular sizes of the amplified toxins genes hblC and cytK to be 695 and 565 bp, respectively (Fig. 1). Multiplex PCR technique has been used for the rapid detection and discrimination of enterotoxin genes in B. cereus (Guinebretiere et al. 2006; Ngamwongsatit et al. 2008), and also for the direct detection of food contamination with enterotoxigenic B. cereus (Ombui et al. 2008). Abdou et al. (2011) reported that the multiplex PCR amplification enabled the rapid detection and identification of enterotoxin genes in food-borne bacteria suchas B. cereus and Staphylococcus aureus.

Fig. 1

Agarose gel showing PCR amplicon resulting from amplification of enterotoxin genes hblC and cytK using the FHblC and RHblC and FCytK and R2CytK primer pairs, respectively. The gel reveals the presence of both enterotoxin genes (hblC and cytK) in tested strain B. cereus F23. Lane M 100-bp DNA ladder marker, lane 1 DNA amplicon of B. cereus F23)

Under specific conditions, mild heat treatments might even activate rather than inactivate dormant spores, thereby increasing the risk of pathogen outgrowth and food poisoning (Kim and Foegeding 1990). Heat resistance of microorganisms is expressed in D and Z values (Heldman and Singh 2001). The tested strain population showed high levels of heat resistance since the spores are thermoresistant and can survive quite harsh heat treatments. Thermal resistance of B. cereus F23 spores was determined by the calculated D values at 36, 25, 19, and 16 min after heat treatment at 65, 75, 85, and 95 °C, respectively. The Z value used as reference to calculate heat adequacy was 0.119 °C (Figs. 2, 3). Curtis (2007) stated that B. cereus spores can vary in their resistance to heat with D₈₅ values of 33.8–106 min and D₉₅ values of between 1.2 and 36 min, and that spores are more heat resistant in high fat or low water activity products.

Fig. 2

D value (decimal reduction times) of thermal resistance of B. cereus F23 (determination of D value by using linear equation Y = aX + b, where D value = 1/slope (a) min)

Fig. 3

Z value of thermal resistant B. cereus F23

Due to the high heat resistance of B. cereus endospores (Choma et al. 2000) and the increasing demand of consumers for lightly processed foods, considerable research has been devoted to improve mild thermal processing techniques and the development of alternative procedures (Lado and Yousef 2002). Most of these techniques do not efficiently inactivate spores of B. cereus, so the use of LAB as biological preservatives on meat products could confer health benefits to the consumers. A comprehensive note has been reported by Olaoye and Idowu (2010) on the various features and properties of LAB used as biological preservatives in meat processing. Most LAB are generally recognized as safe (Silva et al. 2002). They are used to ensure safety, preserve food quality, develop characteristic flavors, and improve the nutritional qualities of food. In this study, further control of B. cereus F23 is achieved by LAB. Plate 1 shows the antagonistic effect of 16 different isolates of LAB against B. cereus F23 using the disc diffusion agar method. Isolate LAB 14, isolated from pickles, possessed the highest antibacterial effect determined as inhibition zone diameter (12 mm).

Plate 1

Photographs showing the antagonistic effect of 16 different LAB strains against the tested strain B. cereus F23

Identity of the most potent LAB strain, no. 14, was later confirmed by amplification of its 16S rRNA gene as Lactobacillus plantarum and it was submitted to GenBank under accession number JX282192.

Lactic acid bacteria are able to produce antimicrobial substances, sugar polymers, sweeteners, aromatic compounds, useful enzymes, or nutraceuticals, or LAB with health-promoting properties, so-called probiotic strains (Olivera et al. 2008, Olaoye et al. 2010). LAB have attracted much attention due to their extensive incorporation as biopreservatives ingredients into food stuffs (Olaoye 2010; Olaoye and Dodd 2010). This represents a way of replacing chemical additives by natural compounds (Pidcock et al. 2002). The control of microorganisms in meat products is a major concern in the preparation of high quality foods (Jo et al. 2004). In meat, production of one or more antagonistic metabolites may be part of the complex mechanism by which a micro-organism becomes established in the presence of other competing organisms (Holzapfel 1998). In the present study, death or survival of B. cereus F23 (10⁵ CFU/ml) in sterile minced meat and BHI broth media was investigated when mixed with L. plantarum F14 cells (10⁵ CFU/ml) under some cultural conditions. Table 4 shows the effect of different incubation periods (h) on viability of B. cereus F23 grown in both minced meat and BHI broth media, alone and mixed with L. plantarum F14. The Bacillus cereus F23 population was reduced by about 5 log cycles when mixed with LB14 cells in minced meat after 36 h incubation and by 4 log cycles in BHI broth after 30 h incubation. The observed antagonism might refer to inhibition through competition for nutrients and/or production of one or more antimicrobial active metabolites (Holzapfel et al. 1995).

Table 4 Effect of different incubation periods on viability of Bacillus cereus F23 grown in minced meat and Brain Heart Infusion (BHI) broth media at 35 °C alone and in the presence of Lactobacillus plantarum F14 (LB14)

Bacillus species are mesophilic bacteria that produce heat-resistant endosopores with a growth range of 10–48 °C, with optimal growth at 28–35 °C. In addition, they can grow in a broad pH range of 4.9–9.3 (Schneider et al. 2004). Results in Table 5 reveal that counts of B. cereus F23 decreased when mixed with a cell suspension of L. plantarum F14 by 4 and 5 log cycles after incubation for 24 h at 35 °C in minced meat and BHI broth, respectively. Obviously, ^ainhibitory effect of LAB cells suspension against B. cereus F23 was greater in BHI broth media than in meat samples. The antagonistic effect of LAB might be due to lowering of the pH value of the surrounding medium, competition for nutrients, or production of inhibitory metabolites (Stiles 1996). Shelar et al. (2012) stated that the antimicrobial activities of Bacillus atrophaeus JS-2 against Bacillus cereus was seen between pH 5 and 8 when the organism was grown at 40 °C.

Table 5 Effect of different incubation temperatures on viability of Bacillus cereus F23 grown in minced meat and Brain Heart Infusion (BHI) broth media for 24 h alone and in presence of Lactobacillus plantarum F14 (LB14)

Increasing inoculum sizes (control, 10³, 10⁴, 10⁵, and 10⁶ CFU/ml) of LAB14 at different temperatures (8, 37, and 55 °C) caused a recognizable decrease in protease and lecithinase production by B. cereus F23. Also, the hemolytic activity of the toxigenic strain was completely inhibited in the presence of all used inoculum sizes of LAB (Table 6).

Table 6 Effect of inoculum size of Lactobacillus plantarum F14 on virulence factors of B. cereus F23 at different incubation temperatures for 24 h

The food industry is expected to produce safe, healthy and nutritious products of high quality. For many food products, using LAB as an essential part of the production process is essential as a biopreservative to improve food safety by inactivating pathogens, virulent enzymes and spoilage microorganisms via acid production and bacteriocins. Furthermore, it is essential that potential biopreservative cultures show no pathogenic or toxic activities.