Skip to main content
Download PDF
  • Original Article
  • Published:

Screening and identification of an Enterobacter ludwigii strain expressing an active β-xylosidase

Annals of Microbiology volume 68, pages 261–271 (2018)Cite this article

Abstract

Researchers have expressed increasing interest in the xylanolytic enzymes used in hemicellulose hydrolysis that convert wood and agricultural residues to second-generation biofuels. In our study, 32 isolates showed clear hydrolysis zones on agar plates containing xylan after Congo red staining. Among these isolates, strain LY-62 exhibited the highest β-xylosidase activity (1.29 ± 0.05 U/mL). According to the phylogenetic analysis of the 16S rDNA, strain LY-62 belongs to the Enterobacter genus. Using a combination of electron microscopy, Gram-staining, and conventional physiological and biochemical examinations, the strain LY-62 was identified as Enterobacter ludwigii. The β-xylosidase gene from Enterobacter ludwigii LY-62 was cloned, and the full-length protein was expressed in Escherichia coli as an N-terminal or C-terminal His-tagged fusions protein. Optimal β-xylosidase activity was achieved at pH 7.0 and 40 °C. The Michaelis constant KM values for His-Xyl62 and Xyl62-His were 1.55 and 2.8 mmol/L, respectively. The kcat values for His-Xyl62 and Xyl62-His were 8.51 and 6.94 s−1, respectively. The catalytic efficiencies of His-Xyl62 and Xyl62-His were 5.49 and 2.48 s−1 × mM−1, respectively. Thus, Xyl62 is a functional β-xylosidase, and our study represents the first report of a β-xylosidase from Enterobacter ludwigii.

Introduction

Xylan is the most abundant hemicellulose present in plant and agricultural residues. The complex heteropolysaccharide consists of a linear backbone of β-1,4-linked d-xylopyranosyl residues, which have multiple substitutions. The complete hydrolysis of the heteropolysaccharide requires the coordinated action of various hydrolytic enzymes (Basaran et al. 2001; Beg et al. 2001). The critical hemicellulases are endo-β-1,4-xylanases (β-1,4-d-xylan xylanohydrolase, EC 3.2.1.8), which can cleave internal glycosidic bonds from the xylan backbone, and β-xylosidase (β-1,4-d-xylan xylohydrolase, EC 3.2.1.37), which hydrolyze xylooligosaccharides from the non-reducing end to xylose. Xylosidase is very important for xylan degradation because xylan is not completely hydrolyzed by xylanases alone. Xylanolytic enzymes are applied in several industrial applications, such as the conversion of lignocellulosic substances to chemicals and fuels, the preparation of materials for scientific research, animal feed digestion, in the food and textile industries, and as bleaching agents in the biopulp and paper processing industries (Wong et al. 1988; Beg et al. 2001; Subramanian and Prema 2002; Techapun et al. 2003; Polizeli et al. 2005; Moure et al. 2006).

Many bacterial and fungal β-xylosidases have been purified and characterized. Currently, fungi (Trichoderma reesei and Aspergillus niger) are widely used as enzyme producers and mainly considered as more relevant commercial xylanolytic enzyme producers than bacteria and yeast (Haltrich et al. 1996; Polizeli et al. 2005; Quinlan et al. 2010). β-Xylosidases isolated from different filamentous fungi exhibit marked differences in their physicochemical and biological properties, as well as their modes of action. Most fungal β-xylosidases display the optimal activity at acidic pH values from 4.0 to 5.0 and the optimum temperatures ranging from 40 to 80 °C (Polizeli et al. 2005). Moreover, β-xylosidases from bacteria are relatively stable under weakly acidic or alkaline conditions and display characteristic properties (Corrêa et al. 2012; Graciano et al. 2012; Hao et al. 2013; Jain et al. 2014; Sanyan et al. 2014).

Although many β-xylosidases and their coding genes have been manipulated and characterized in plants, fungi, bacteria, and archaea, few reports describing the xylanolytic enzyme system of Enterobacter are available (Khandeparkar and Bhosle 2006; Changhao et al. 2009; Campos et al. 2013).

In this report, we describe the screening and identification of an Enterobacter ludwigii strain LY-62 with β-xylosidase activity (the β-xylosidase was designated Xyl62). Furthermore, the Xyl62 gene was cloned from strain LY-62, and bioinformatics and expression analyses were performed. A detailed description of the characteristics of the recombinant proteins is also researched.

Material and methods

Soil sample pretreatment

Soil samples used in this experiment were collected from the native forest of Wangwu Mountain in Henan Province, China, and stored at 4 °C.

Five grams of soil sample was dissolved in 50 mL of sterile distilled water to prepare a liquid suspension, which was sequentially incubated for 60 min at 37 °C and then centrifuged at 200g. Then, the supernatant was removed for enrichment culturing.

Isolation of strains on xylan-agar plates

The prepared supernatant was incubated in enrichment medium which contained 10 g/L beechwood xylan, 5 g/L tryptone, and 5 g/L NaCl and was cultured for 72 h at 37 °C and shaken at 200 g. Aliquots of cultures in enrichment medium were sequentially removed and diluted serially with a 0.9% NaCl solution.

Each serial dilution was spread on a solid medium plate, which contained 0.5 g/L (NH4)2SO4, 1 g/L K2HPO4, 0.3 g/L MgSO4 •7H2O, 0.2 g/L CaCl2, 0.1 g/L K2SO4, 0.2 g/L NaCl, 10 g/L beechwood xylan, and 15 g/L agar (Ammoneh et al. 2014), and incubated for 48 h at 37 °C.

Colonies with identifiable hydrolysis zones were chosen and selected and transferred to a new solid medium plate for further culturing. These plates were then stained with Congo red (1 mg/mL), and colony diameters and hydrolysis zone diameters were measured and recorded.

Isolation of strains with β-xylosidase activity

The isolates derived from the soil collection of Wangwu mountain in Henan province with hydrolysis zone were selected as further screening strains with β-xylosidase activity. The isolates were cultured for 8 h at 37 °C with shaking at 200 g in medium containing 0.5 g/L (NH4)2SO4, 1 g/L K2HPO4, 0.3 g/L MgSO4•7H2O, 0.1 g/L CaCl2, 0.1 g/L K2SO4, 0.2 g/L NaCl, 10 g/L beechwood xylan, and 10 g/L tryptone. Then, 30 mL of each culture was removed and centrifuged at 10000g for 10 min at 4 °C. The supernatant was discarded (no enzyme activity, data not shown), and the precipitate was washed twice with equal volumes of phosphate buffer (0.01 mol/L, pH 7.0) and centrifuged at 10000g for 10 min at 4 °C. The pellet was again suspended in lysis buffer (containing 0.01 mol/L phosphate buffer, pH 7.0, 100 μg/mL lysozyme, and 0.01% Triton X-100). The suspension was ultrasonicated (30 W, 5 s/5 s, 30 min) and then centrifuged at 11000g for 10 min at 4 °C; the supernatant was collected as a crude enzyme solution and used to determine β-xylosidase activity.

The procedure for the β-xylosidase activity assay was as follows: 0.1 mL of properly diluted crude enzyme solution was mixed with 0.9 mL of 0.8 mmol/L p-nitrophenyl-β-d-xyloside (pNPX). The mixture was incubated for 10 min at 50 °C; then, the reaction was terminated by adding 1 mL of 2 mol/L sodium carbonate. The absorbance of the reaction solution was determined at 410 nm (Lachke 1988). One unit of β-xylosidase activity was defined as the amount of enzyme that catalyzed the hydrolysis of pNPX to produce 1 μmol of β-nitrophenol per minute. The specific activity of the crude enzyme solution was defined as the enzyme activity per milligram of protein. The protein content was determined using the Bradford method (Bradford 1976).

Strain identification

Cell morphology of strain was observed under light microscope, scanning electronic microscopy, and transmission electron microscopy. Flagella were investigated with transmission electron microscopy. Cells were mounted on copper grids and negatively stained with 1% potassium phosphotungstate (pH 7.0). Then, the grids were examined under a transmission electron microscope.

Total DNA was extracted from strain LY-62 using the TIANamp Bacteria DNA Kit (TIANGEN). Using total DNA as the template and Eubac 27F and 1492R which are universal primers for 16S RNA amplification, the 16S rDNA gene was amplified by PCR. PCR products were visualized on 1% agarose gels with Gelred stain, and the target gene was purified and cloned into the pMD™19-T vector. The recombinant plasmid was transformed into Escherichia coli strain DH5a, and positive clones were sequenced with RV-M and M13-47 primers. The phylogenetic tree was constructed using MEGA7.0 software and with the neighbor-joining method (Saitou and Nei 1987) as the tree-building algorithm and a bootstrap analysis (1000 replications) were performed to evaluate the stability of the resulting phylogenetic tree.

Gram staining was conducted using a Gram stain kit according to the manufacturer’s instructions. Other carbon-source utilization tests, acid production tests, and additional physiological tests were performed according to the manufacturer’s instructions (Hoffmann et al. 2005).

Cloning and expression of the β-xylosidase gene

The β-xylosidase gene from Enterobacter cloacae P101 (accession number CP006580.1) was selected as a reference sequence, and two pairs of primers were designed to clone the complete β-xylosidase gene from Enterobacter ludwigii LY-62:

  • LY-3NdeI: 5’GGAATTCCATATGACAACGATAACAAACC3’

  • LY-4XhoI: 5’CCGCTCGAGCTATTTCGCGAGCGGTTCGTAGGTG3’

  • LY-5NcoI: 5’CATGCCATGGGCATGACAACGATAACAAACC3’

  • LY-6XhoI: 5’CCGCTCGAGTTTTCGCGAGCGGTTCGTAGGTG3’

The β-xylosidase gene of Enterobacter ludwigii LY-62 was amplified by PCR. The amplified products were visualized on 1% agarose gels with Gelred staining, and the target band was retrieved and sequenced. The amplified products were ligated into the pET-28a(+) vector using the NdeI/XhoI cleavage sites for N-terminal fusion proteins and NcoI/XhoI cleavage sites for C-terminal fusion proteins, and transformed into E. coli BL21(DE3). The expression of the recombinant proteins was induced with 0.5 mmol/L isopropyl-β-d-thiogalactopyranoside. Recombinant proteins were purified using the 6×His-Tagged Protein Purification Kit (CWBIO) (20 mmol/L phosphate buffer, pH 7.0, 500 mmol/L NaCl, and 500 mmol//L imidazole as the elution buffer).

Characterization of enzyme activity

The optimum pH of β-xylosidase was determined by measuring its activity at pH values ranging from 5.0 to 9.0 using sodium citrate (pH 5.0–6.0, 50 mM), phosphate (pH 6.2–8.8, 50 mM), and Tris-HCl (pH 8.4–8.8, 50 mM) buffers. The enzyme activity measured at the optimum pH value was set to 100%, and the relative enzyme activity was defined as a percentage of the optimal enzyme activity at various pH values. The pH stability was determined by preparing enzyme solutions using buffers with different pH values and incubating the resulting mixtures for 12 h at 4 °C. The residual β-xylosidase activity was then determined. The residual enzyme activity was defined as the percentage of enzyme activities measured at various pH values relative to the highest enzyme activity.

The optimum temperature of β-xylosidase was determined at different temperatures (30–65 °C). The enzyme activity measured at the optimum temperature was set as to 100%, and the relative enzyme activity was defined as the percentage of enzyme activities at various temperatures relative to the highest enzyme activity. For the determination of the temperature stability, the crude enzyme solution (phosphate buffer, 50 mM, pH 7.0) was incubated at different temperatures (35–55 °C) for 10, 20, 40, 60, 90, or 120 min. At specified times, sample tubes were withdrawn, cooled on ice and the residual activity was measured.

Different metal ions were added to the pNPX solution to final concentrations was of 2 or 10 mmol/L. The enzyme solution was reacted with the pNPX solution containing different metal ions, and the enzyme activity was measured. The relative enzyme activity was defined as the percentage of enzyme activities in the presence of different metal ions relative to the enzyme activity in the absence of metal ions.

One hundred microliters of enzyme solution (0.11 mg/mL of His-Xyl62 or 0.073 mg/mL of Xyl62-His) was mixed with 900 μL of pNPX solution (0.125–10 mmol/L, pH 7.0) and incubated at 40 °C, and the absorbance at 410 nm was monitored continuously for 30 min to determine the KM and kcat values for His-Xyl62 and Xyl62-His.

The accession numbers of the 16S rDNA gene and β-xylosidase gene from Enterobacter ludwigii LY-62 in the GenBank database are KU867644.1 and KU870672.1, respectively.

Results

Screening of strains with β-xylosidase activity

Solid medium plates were used to isolate microorganisms with xylanolytic enzyme activity, based on the presence of identifiable hydrolysis zones around colonies after Congo red staining. In the present study, 32 strains showing hydrolysis zones were isolated (all of which belong to Enterobacter, data not shown). Strain number 62 (designated strain LY-62) produced the largest hydrolysis zone of the bacterial strains isolated (Fig. 1).

Fig. 1
figure 1

Hydrolysis zone of E. ludwigii LY-62

Full size image

Thirty-two strains with hydrolysis zones were selected for further screening to identify strains with intracellular β-xylosidase activity. All 32 strains were measured and confirmed to display β-xylosidase activity, and the results are shown in Table 1. Strain LY-62 exhibited the highest β-xylosidase activity, as the β-xylosidase activity per milliliter of crude lysate and per milligram of total proteins in the extract were 1.29 ± 0.05 U/mL and 1.05 ± 0.16 U/mg, respectively.

Table 1 β-xylosidase activity of 32 strains
Full size table

Strain LY-62 was selected for further study of its β-xylosidase activity. Values of end-point β-xylosidase activity obtained after a series fixed time of fermentation are shown (Fig. 2). The maximal β-xylosidase activity was observed after 8 h of fermentation, and the result was partially consistent with the bacterial growth.

Fig. 2
figure 2

Time course of β-xylosidase production in E. ludwigii LY-62. Black triangle: enzyme activity; black square: specific activity

Full size image

Identification of strain LY-62

Strain LY-62 was cultured on Lysogeny Broth agar medium for 24 h at 37 °C, after which visible colonies formed, with round (2–3 mm in diameter) and regular edges, a convex surface, a light beige to white, opaque, and glossy appearance. Strain LY-62 is a gram-negative bacterium with flagella (Fig. 3).

Fig. 3
figure 3

Morphological characteristics of strain LY-62. a Visible colonies of strain LY-62 on Lysogeny Broth agar medium. b Morphology of strain LY-62 under a light microscope. c Images of strain LY-62 after Gram staining. d Morphology of strain LY-62 under a scanning electronic microscope. e Morphology of strain LY-62 under a transmission electron microscope

Full size image

Analyzing the alignment of 16SrRNA sequences from LY-62 strain with sequences from the 16SrRNA database from Genbank, a high similarity was observed with sequences from Enterobacter genus. The closest relatives of strain LY-62 were Enterobacter cloacae UW5, E. cloacae P101, E. cloacae EcWSU1, and the recently described Enterobacter ludwigii strain type EN-119 (99.87, 99.87, 99.87, and 99.93% certainty, respectively). The phylogenetic tree showed that strain LY-62 was verifiably affiliated with the species E. ludwigii (Fig. 4).

Fig. 4
figure 4

Phylogenetic tree showing the phylogenetic position of the strain LY-62 using the neighbor-joining method based on 16S rDNA sequences. The numbers at the nodes indicate the levels of the bootstrap support percentages based on neighbor-joining of 1000 replicates. Bootstrap values which were ≥ 50% are indicated at the nodes. The scale bar represents a 0.02 sequence difference. B. subtilis 168 was used as an outgroup

Full size image

The physiological and biochemical characteristics of strain LY-62 were investigated in a series of experiments and summarized in Table 2. E. ludwigii is distinguished from the other Enterobacter species based on its growth on myo-inositol and 3-O-methyl-d-glucopyranose. The physiological and biochemical results further supported the conclusion that strain LY-62 is E. ludwigii (Boone et al. 2001; Hoffmann et al. 2005).

Table 2 Physiological and biochemical characteristics of LY-62
Full size table

Analysis of the β-xylosidase gene

Simplex band corresponding to amplification products which contain β-xylosidase gene of 1620 bp was exhibited on agarose gel, and purified proteins Xyl62-His and His-Xyl62 were presented using SDS-PAGE (Fig. 5). A homology search was performed for the β-xylosidase gene using BLASTN, which displayed high similarity with the β-xylosidase genes from E. cloacae P101, E. cloacae EcWSU1, E. cloacae UW5, and E. ludwigii EN-119 (98.52, 98.40, 98.09, and 98.02% similarity, respectively).

Fig. 5
figure 5

Agarose electrophoretogram of DNA and SDS-PAGE electrophoretogram of proteins. a Lane M: DL 5000 DNA Marker. Lane 1: PCR product using by primers LY-3Nde1 and LY-4Xho1. Lane 2: PCR product using by primers LY-5Nco1 and LY-6Xho1. b Lane M: premixed protein marker (low) (TaKaRa). Lane 1: extracellular supernatant of BL21(DE3) containing empty pET-28a(+). Lane 2: extracellular supernatant of BL21(DE3) containing His-Xyl62. Lane 3: purified His-Xyl62. Lane 4: extracellular supernatant of BL21(DE3) containing Xyl62-His. Lane 5: purified Xyl62-His

Full size image

The predicted amino acid sequence of the β-xylosidase (designated as Xyl62) gene from Enterobacter ludwigii LY-62 (539 amino acids) was submitted for BLAST analysis, and the protein showed the highest similarities with two GH43 β-xylosidases from E. cloacae (99%, gi| 643377338) and Enterobacter sp. BIDMC 26 (99%, gi| 695753277). Based on the phylogenetic analysis of the evolutionary relationship of the predicted amino acid sequence of Xyl62, Xyl62 belongs to the GH43 family in the CAZY database (http://www.cazy.org/) (Coutinho and Henrissat 1999), with the closest relation to a β-xylosidase (Xyl43; 98% consensus, 94% identity; NCBI accession AFZ78871) from Enterobacter sp. enrichment culture clone nf1B6 (Campos et al. 2013), a beta-xylosidase (YagH; 99% consensus, 94% identity; NCBI accession AMX06955) from E. asburiae (Liu et al. 2016), a predicted xylosidase/arabinosidase (YagH; 99% consensus, 93% identity; NCBI accession AGX32436) from synthetic Escherichia coli 321.deltaA (Lajoie et al. 2013) and a β-xylosidase from E. cloacae subsp. cloacae NCTC 9394 (99% consensus, 94% identity; NCBI accession CBK87506). Thus, the β-xylosidase from E. ludwigii LY-62 belonged to the GH43 family. Xyl62 had a theoretical molecular weight (MW) of 61.29 kDa, an isoelectric point (IP) of 5.41 and parameters of high stability (http://web.expasy.org/cgi-bin/protparam/protparam). These properties of Xyl62 are similar to the first reported β-xylosidase (Xyl43) from Enterobacter sp. (E. cloacae), with an MW 60.84 kDa and an IP of 5.53 (Campos et al. 2013).

Expression of β-xylosidase

The gene of β-xylosidase Xyl62 was expressed as either an N- or C-terminal His-tagged fusion protein to confirm that this gene encoded a functional enzyme. The biological function of gene encoded β-xylosidase Xyl62 was verified by the clone and expression. The predicted MW and IP of the recombinant His-Xyl62 (N-terminal His-tagged fusion) and Xyl62-His (C-terminal His-tagged fusion) proteins were MW = 63.45 kDa/IP = 5.76 and MW = 62.80 kDa/IP = 5.54, respectively. In comparison, the predicted MW and IP of the recombinant His-Xyl43 and Xyl43-His proteins were 64.4 kDa/5.85 and 61.66 kDa/5.70, respectively (Campos et al. 2013). Purification of His-Xyl62 and Xyl62-His under native conditions was achieved, and the recombinant proteins were observed by SDS-PAGE (Fig. 5b). Purified solutions were tested for β-xylosidase activity, and the specific activities of His-Xyl62 and Xyl62-His were 74.75 and 77.23 mU/mg, respectively.

Characterization of the recombinant β-xylosidase enzyme activity

The activities of the recombinant proteins were characterized using pNPX as a substrate and measuring β-nitrophenol (pNP) release by monitoring Abs410nm. Both His-Xyl62 (N-terminal His-tagged fusion) and Xyl62-His (C-terminal His-tagged fusion) presented β-xylosidase activity.

As shown in Fig. 6a, His-Xyl62 and Xyl62-His showed optimal activity at pH 7.0. When the pH value was less than 7.0, the β-xylosidase activity increased as the pH value increased. At pH values ranging from 6.8 to 8.0, the relative activities were preserved at levels greater than 80%. His-Xyl43 demonstrated high β-xylosidase activity at pH values ranging between 5.5 and 7, with the highest activity measured at pH 6 at 50 °C (Campos et al. 2013). His-Xyl62 and Xyl62-His showed high stability at pH values ranging from 6.0 to 8.0 (up to 80% activity) (Fig. 6b). The optimum temperature for His-Xyl62 and Xyl62-His was 40 °C (Fig. 6c), and both proteins displayed high activity levels at 35–45 °C (Fig. 6d, e).

Fig. 6
figure 6

Characterization of the His-Xyl62 and Xyl62-His enzyme activities. a The effect of different pH values on activity. b pH stability of His-Xyl62 and Xyl62-His. c The effect of different temperatures on activity. d Temperature stability of His-Xyl62. e Temperature stability of Xyl62-His. In a, b, and c, the black triangle represents His-Xyl62, and the black square represents Xyl62-His. In d, e, the black diamond represents 35 °C, the black square represents 40 °C, the black triangle represents 45 °C, the black transverse line represents 50 °C, and the black circle represents 55 °C

Full size image

The β-xylosidase activity was assayed in the presence of several metal ions, such as Ni2+, Zn2+, K+, Ca2+, Mg2+, and Co2+, at 2 and 10 mmol/L concentrations. Remarkably, Ca2+ improved the enzymatic activity up to 150–220%, and Mg2+ inhibited the enzymatic activity to 50% of its optimal level. Other metal ions exhibited slight effects on the enzymatic activity (Fig. 7).

Fig. 7
figure 7

Effects of different metal ions on enzyme activity. White: 2 mmol/L (His-Xyl62), light upward diagonal line: 10 mmol/L (His-Xyl62), dotted diamond:2 mmol/L (Xyl62-His), light downward diagonal line: 10 mmol/L (Xyl62-His). The figure demonstrated that six metal ions represented divergent effects to the enzymatic activity, and Ca2+ improves the enzymatic activity while Mg2+ inhibits the enzymatic activity

Full size image

The results of kinetic studies of His-Xyl62 and Xyl62-His using pNPX as the substrate are shown in Fig. 8. The KM and kcat values for His-Xyl62 were 1.55 mmol/L and 8.51 s−1, respectively. The KM and kcat values for Xyl62-His were 2.80 mmol/L and 6.94 s−1, respectively. The differences of the kinetic parameters between His-Xyl62 and Xyl62-His are likely caused by the position of His tag. In comparison, the catalytic efficiencies of His-Xyl62 and Xyl62-His were better than His-Xyl43, with a KM of 2.92 mmol/L and a kcat of 1.32 s−1, respectively (Campos et al. 2013). The catalytic efficiency values of the β-xylosidase from E. ludwigii LY-62 were 5.49 s−1 × mM−1 (His-Xyl62) and 2.48 s−1 × mM−1 (Xyl62-His).

Fig. 8
figure 8

Nonlinear regression fitting to the Michaelis–Menten equation for hydrolysis rates versus pNPX concentrations. Black triangle: His-Xyl62; black square: Xyl62-His. The figure exhibited the kinetic studies of His-Xyl62 and Xyl62-His using pNPX as substrate

Full size image

Discussion

Strains with identifiable hydrolysis zone on xylan-agar plates displayed with xylanolytic enzyme activity and were selected for further screening for the presence of β-xylosidases. The strain with the highest β-xylosidase activity, LY-62, was confirmed as E. ludwigii, which is assigned to the E. cloacae complex. Eight species are included in the E. cloacae complex: E. ludwigii, E. asburiae, E. cloacae, E. dissolvens, E. hormaechei, E. kobei, E. nimipressuralis, and E. cancerogenus. The species and genovars of the E. cloacae complex are close genetic and phenotypic relatives (Hoffmann et al. 2005).

Xyl62 belongs to the endoenzyme family. Prokaryotic β-xylosidases are intracellular enzymes, whereas fungal β-xylosidases are extracellular or cell wall-binding enzymes (Nieto-Domínguez et al. 2015). Compared to the GH43 β-xylosidase (NCBI accession JX569191) from Enterobacter sp., the gene sequence and predicted amino acid sequence of Xyl62 displayed 90 and 94% identity, respectively. GH43 hemicellulolytic enzymes are promising candidates for β-xylosidase activity, as they do not display transglycosylation at high substrate concentrations (Jordan et al. 2007). Commercially applied GH43 β-xylosidases are derived four different bacteria, including Alkaliphilus metalliredigens, Bacillus pumilus, Bacillus subtilis subsp. subtilis str. 168, and Lactobacillus brevis (ATCC367), and these enzymes have been characterized under different biochemical conditions. They showed functional stability within the range from pH 4.5 to pH 10.5 and displayed thermal stability from 25 to 40 °C (Jordan et al. 2012). The properties of the GH43 β-xylosidases with properties differ from other GH family β-xylosidases and may be suitable for use in enzyme cocktails (Lombard et al. 2014).

The corresponding amino terminal portion of Xyl62 contains a conserved domain of 300 amino acids that is common to β-xylosidases and contains the active site. Another conserved domain of unknown function (classified as DUF1349 superfamily in NCBI database) is located in the 145 amino acids in the carboxy terminus. Further studies are required to explore whether this DUF1349 superfamily conserved domain plays a necessary role in the enzyme activity.

His-Xyl62 and Xyl62-His showed high stability at pH values ranging from 6.0 to 8.0, and both proteins displayed high activity levels at 35–45 °C. His-Xyl62 and Xyl62-His should be suitable for the commercial applications on neutral and mesophilic conditions. Interestingly, some β-xylosidases from thermophilic bacteria and archaea have been reported. The optimal reaction conditions are pH 6.0 and 65 °C for β-xylosidases XylC from Thermoanaerobacterium saccharolyticum JW/SL-YS485, as well as the recombinant XylCrec using pNPX as the substrate (Weilan et al. 2011). The GH43 β-xylosidase XynB3 from Geobacillus stearothermophilus T-6 has the highest activity at 65 °C and pH 6.5, with a clear preference for xylose-based substrates (Shallom et al. 2005). However, the β-xylosidases from Bacillus thermantarcticus (Lama et al. 2004) and Bifidobacterium adolescentis display optimal activity at pH 5.0–7.0 and 50–70 °C (Lagaert et al. 2011). The increasing focus on thermostable xylosidases indicates that Xyl62 may be subjected to molecular modifications to improve thermostability.

The activities of some β-xylosidases, such as Xyl62, are significantly enhanced by Ca2+, including enzymes from Neocallimastix frontalis (Studier 2005), Scytalidium thermophilum (Zanoelo et al. 2004), and Humicola insolens (Xinzhou et al. 2014). Ca2+ slightly enhances the activity of β-xylosidases from S. thermophilum (Zanoelo et al. 2004), Aureobasidium (Hayashi et al. 2001), Paecilomyces thermophila (Yan et al. 2008) and Aspergillus phoenicis (Rizzatti et al. 2001). According to other studies, Ca2+ does not enhance the activity of the β-xylosidase from B. thermantarcticus (Lama et al. 2004), and it slightly inhibited the activity of the β-xylosidase from Phanerochaete chrysosporium (Huy et al. 2013).

The determined kinetic parameters and relative parameters of GH43 β-xylosidases from different bacterial sources are listed in Table 3. For comparison, the kcat/KM value of the β-xylosidase from Enterobacter sp. is 0.45 s−1 × mM−1 (Campos et al. 2013). The catalytic efficiency value of the E. ludwigii LY-62 β-xylosidase is lower than β-xylosidases from Thermobifida fusca YX (Moraïs et al. 2012), Selenomonas ruminantium (Jordan and Braker 2011), Bacillus pumilus IPO (Xu et al. 1991), Weissella spp. strain 92 (Falck et al. 2015), and Lactobacillus brevis ATCC 367 (Jordan et al. 2012). However, the study of β-xylosidase enzymatic characteristics should focused on the differences for the diversified applications.

Table 3 Catalytic efficiency of GH 43 β-xylosidases from different bacteria on pNPX
Full size table

E. ludwigii has rarely been studied as a bacterium containing a xylanolytic enzyme system. In the present study, E. ludwigii LY-62 with high β-xylosidase activity was isolated and identified. The β-xylosidase Xyl62 from E. ludwigii LY-62 was studied and successfully expressed as fusion proteins. Both the N-terminal and C-terminal His-tagged fusion proteins were confirmed as functional β-xylosidases with distinct characteristics. This report is the first to describe a β-xylosidase from E. ludwigii.

References

  • Ammoneh H, Harba M, Akeed Y, Al-Halabi M, Bakri Y (2014) Isolation and identification of local Bacillus isolates for xylanase biosynthesis. Iran J Microbiol 6(2):127–132

    PubMed  PubMed Central  Google Scholar 

  • Basaran P, Hanq YD, Basaran N, Worobo RW (2001) Cloning and heterologous expression of xylanase gene from Pichia stipitis in Escherichia coli. J Appl Microbiol 90(2):248–255

    Article  CAS  PubMed  Google Scholar 

  • Beg QK, Kapoor M, Mahajan L, Hoondal GS (2001) Microbial xylanases and their industrial applications: a review. Appl Microbiol Biotechnol 56(3–4):326–338

    Article  CAS  PubMed  Google Scholar 

  • Boone DR, Castenholz RW, Garrity GM, Bergey DH (2001) Bergey’s manual of systematic bacteriology. Springer, New York

  • Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254

    Article  CAS  PubMed  Google Scholar 

  • Campos E, Negro MJ, Lorenzo GSD, Gonzalez S, Rorig M, Talia P, Grasso DH, Sáez F, Manzanares Secades P, Ballesteros Perdices M, Cataldi AA (2013) Purification and characterization of a GH43 β-xylosidase from Enterobacter sp. identified and cloned from forest soil bacteria. Microbiol Res 169(2–3):213–220

    PubMed  Google Scholar 

  • Changhao B, Xueli Z, Ingram LO, Preston JF (2009) Genetic engineering of Enterobacter asburiae strain JDR-1 for efficient production of ethanol from hemicellulose hydrolysates. Appl Environ Microbiol 75(18):5743–5749

    Article  Google Scholar 

  • Corrêa JM, Graciano L, Abrahão J, Loth EA, Gandra RF, Kadowaki MK, Henn C, Simão R (2012) Expression and characterization of a GH39 β-xylosidase II from Caulobacter crescentus. Appl Biochem Biotechnol 168(8):2218–2229

    Article  PubMed  Google Scholar 

  • Coutinho PM, Henrissat B (1999) Carbohydrate-active enzymes: an integrated database approach. In: Gilbert HJ, Davies G, Henrissat H, Svensson B (eds) Recent advances in carbohydrate bioengineering. The Royal Society of Chemistry, Cambridge, pp 3–12

    Google Scholar 

  • Falck P, Linares-Pastén JA, Adlercreutz P, Karlsson EN (2015) Characterization of a family 43 β-xylosidase from the xylooligosaccharide utilizing putative probiotic Weissella sp. strain 92. Glycobiology 26(2):193–202

    Article  PubMed  PubMed Central  Google Scholar 

  • Graciano L, Corrêa JM, Gandra RF, Seixas F, Kadowaki MK, Sampaio SC, Silva J, Osaku CA, Simão R (2012) The cloning, expression, purification, characterization and modeled structure of Caulobacter crescentus β-xylosidase I. World J Microbiol Biotechnol 28:2879–2888

    Article  CAS  PubMed  Google Scholar 

  • Haltrich D, Nidetzky B, Kulbe KD, Steiner W, Zupancic S (1996) Production of fungal xylanases. Bioresour Technol 58:137–161

    Article  CAS  Google Scholar 

  • Hao S, Xun L, Huaxiang G, Yu Z, Yingjuan H, Liangliang W, Wang F (2013) Biochemical properties of a novel thermostable and highly xylose-tolerant β-xylosidase/α-arabinosidase from Thermotoga thermarum. Biotechnol Biofuels 6:27

    Article  Google Scholar 

  • Hayashi S, Ohno T, Ito M, Yokoi H (2001) Purification and properties of the cell-associated β-xylosidase from Aureobasidium. J Ind Microbiol Biotechnol 26(5):276–279

    Article  CAS  PubMed  Google Scholar 

  • Hoffmann H, Stindl S, Stumpf A, Mehlen A, Monget D, Heesemann J, Schleifer KH, Roggenkamp A (2005) Description of Enterobacter ludwigii sp. nov., a novel Enterobacter species of clinical relevance. Syst Appl Microbiol 28(3):206–212

    Article  CAS  PubMed  Google Scholar 

  • Huy ND, Thayumanavan P, Kwon TH, Park SM (2013) Characterization of a recombinant bifunctional xylosidase/arabinofuranosidase from Phanerochaete chrysosporium. J Biosci Bioeng 116(2):152–159

    Article  CAS  PubMed  Google Scholar 

  • Jain I, Kumar V, Satyanarayana T (2014) Applicability of recombinant β-xylosidase from the extremely thermophilic bacterium Geobacillus thermodenitrificans in synthesizing alkylxylosides. Bioresour Technol 170:462–469

    Article  CAS  PubMed  Google Scholar 

  • Jordan DB, Braker JD (2011) Opposing influences by subsite −1 and subsite +1 residues on relative xylopyranosidase/arabinofuranosidase activities of bifunctional β-D-xylosidase/α-L-arabinofuranosidase. Biochim Biophys Acta 1814:1648–1657

    Article  CAS  PubMed  Google Scholar 

  • Jordan DB, Li XL, Dunlap CA, Whitehead TR, Cotta MA (2007) Structure-function relationships of a catalytically efficient beta-D-xylosidase. Appl Biochem Biotechnol 141(1):51–76

    Article  CAS  PubMed  Google Scholar 

  • Jordan DB, Stoller JR, Lee CC, Chan VJ, Wagschal K (2017) Biochemical characterization of a GH43 β-xylosidase from Bacteroides ovatus. Appl Biochem Biotechnol 182:250–260

  • Jordan DB, Wagschal K, Grigorescu A, Braker JD (2012) Highly active β-xylosidases of glycoside hydrolase family 43 operating on natural and artificial substrates. App Microbiol Biotechnol 97:4415–4428

    Article  Google Scholar 

  • Khandeparkar R, Bhosle NB (2006) Purification and characterization of thermoalkalophilic xylanase isolated from the Enterobacter sp. MTCC 5112. Res Microbiol 157(4):315–325

    Article  CAS  PubMed  Google Scholar 

  • Lachke AH (1988) 1,4-β-D-Xylan xylohydrolase of Sclerotium rolfsii. Methods Enzymol 160C(C):679–684

    Article  Google Scholar 

  • Lagaert S, Pollet A, Delcour JA, Lavigne R, Courtin CM, Volckaert G (2011) Characterization of two β-xylosidases from Bifidobacterium adolescentis and their contribution to the hydrolysis of prebiotic xylooligosaccharides. Appl Microbiol Biotechnol 92:1179–1185

    Article  CAS  PubMed  Google Scholar 

  • Lajoie MJ, Rovner AJ, Goodman DB, Aerni HR, Haimovich AD, Kuznetsov G, Mercer JA, Wang HH, Carr PA, Mosberg JA, Rohland N, Schultz PG, Jacobson JM, Rinehart J, Church GM, Isaacs FJ (2013) Genomically recoded organisms expand biological functions. Science 342(6156):357–360

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Lama L, Calandrelli V, Gambacorta A, Nicolaus B (2004) Purification and characterization of thermostable xylanase and β-xylosidase by the thermophilic bacterium Bacillus thermantarcticus. Res Microbiol 155(4):283–289

    Article  CAS  PubMed  Google Scholar 

  • Liu F, Yang J, Xiao Y, Li L, Yang F, Jin Q (2016) Complete genome sequence of a clinical isolate of Enterobacter asburiae. Genome Announc 4(3):e00523-16

    Article  PubMed  PubMed Central  Google Scholar 

  • Lombard V, Ramulu HG, Drula E, Coutinho PM, Henrissat B (2014) The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 42:490–495

    Article  Google Scholar 

  • Moraïs S, Alber OS, Barak Y, Hadar Y, Wilson DB, Lamed R, Shoham Y, Bayer EA (2012) Functional association of catalytic and ancillary modules dictates enzymatic activity in glycoside hydrolase family 43 β-xylosidase. J Biol Chem 287(12):9213–9221

    Article  PubMed  PubMed Central  Google Scholar 

  • Moure A, Gullón P, Domínguez H, Parajó JC (2006) Advances in the manufacture, purification and applications of xylo-oligosaccharides as food additives and nutraceuticals. Process Biochem 41(9):1913–1923

    Article  CAS  Google Scholar 

  • Michlmayr H, Hell J, Lorenz C, Böhmdorfer S, Rosenau T, Kneifel W (2013) Arabinoxylan oligosaccharide hydrolysis by family 43 and 51 glycosidases from Lactobacillus brevis DSM 20054. Appl Environ Microbiol 79(21):6747–6754

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Nieto-Domínguez M, LId E, Barriuso J, Prieto A, BFd T, Canales-Mayordomo Á, Martínez MJ (2015) Novel pH-stable glycoside hydrolase family 3 β-xylosidase from Talaromyces amestolkiae: an enzyme displaying regioselective transxylosylation. Appl Environ Microbiol 81(18):6380–6392

    Article  PubMed  PubMed Central  Google Scholar 

  • Polizeli ML, Rizzatti AC, Monti R, Terenzi HF, Jorge JA, Amorim DS (2005) Xylanases from fungi: properties and industrial applications. Appl Microbiol Biotechnol 67(5):577–591

    Article  CAS  PubMed  Google Scholar 

  • Quinlan RJ, Teter S, Xu F (2010) Development of cellulases to improve enzymatic hydrolysis of lignocellulosic biomass. Bioalcohol Production 7:178–201

  • Ratnadewi AAI, Fanani M, Kurniasih SD, Sakka M, Wasito EB, Sakka K, Nurachman Z, Puspaningsih NNT (2013) β-D-Xylosidase from Geobacillus thermoleovorans IT-08: biochemical characterization and bioinformatics of the enzyme. Appl Biochem Biotechnol 170:1950–1964

    Article  CAS  PubMed  Google Scholar 

  • Rizzatti AC, Jorge JA, Terenzi HF, Rechia CG, Polizeli ML (2001) Purification and properties of a thermostable extracellular beta-D-xylosidase produced by a thermotolerant Aspergillus phoenicis. J Ind Microbiol Biotechnol 26:156–160

    Article  CAS  PubMed  Google Scholar 

  • Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4(4):406–425

    CAS  PubMed  Google Scholar 

  • Sanyan Z, Huimin W, Pengjun S, Bo X, Yingguo B, Huiying L, Bin Y (2014) Cloning, expression, and characterization of a thermostable β-xylosidase from thermoacidophilic Alicyclobacillus sp. A4. Process Biochem 49:1422–1428

    Article  Google Scholar 

  • Shallom D, Leon M, Bravman T, Ben-David A, Zaide G, Belakhov V, Shoham G, Schomburg D, Baasov T, Shoham Y (2005) Biochemical characterization and identification of the catalytic residues of a family 43 beta-D-xylosidase from Geobacillus stearothermophilus T-6. Biochemistry 44(1):387–397

    Article  CAS  PubMed  Google Scholar 

  • Sinnott ML (1990) Catalytic mechanisms of enzymic glycosyl transfer. Chem Rev 90(7):1171–1202

    Article  CAS  Google Scholar 

  • Studier FW (2005) Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41(1):207–234

    Article  CAS  PubMed  Google Scholar 

  • Subramanian S, Prema P (2002) Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Crit Rev Biotechnol 22(1):33–64

    Article  Google Scholar 

  • Techapun C, Poosaran N, Watanabe M, Sasaki K (2003) Thermostable and alkaline-tolerant microbial cellulase-free xylanases produced from agricultural wastes and the properties required for use in pulp bleaching bioprocesses: a review. Process Biochem 38(9):1327–1340

    Article  CAS  Google Scholar 

  • Van Doorslaer E, Kersters-Hilderson H, De Bruyne CK (1985) Hydrolysis of β-D-xylo-oligosaccharides by β-D-xylosidase from Bacillus pumilus. Carbohydr Res 140:342–346

    Article  Google Scholar 

  • Viborg AH, Sørensen KI, Gilad O, Steen-Jensen DB, Dilokpimol A, Jacobsen S, Svensson B (2013) Biochemical and kinetic characterisation of a novel xylooligosaccharide-upregulated GH43 β-D-xylosidase/α-L-arabinofuranosidase (BXA43) from the probiotic Bifidobacterium animalis subsp. lactis BB-12. AMB Express 3(1):56

    Article  PubMed  PubMed Central  Google Scholar 

  • Wagschal K, Heng C, Lee CC, Robertson GH, Orts WJ, Wong DW (2009) Purification and characterization of a glycoside hydrolase family 43 beta-xylosidase from Geobacillus thermoleovorans IT-08. Appl Biochem Biotechnol 155(1–3):304–313

    CAS  PubMed  Google Scholar 

  • Weilan S, Yemin X, Ailian W, Kataeva I, Jianjun P, Huawei W, Wiegel J (2011) Characterization of a novel β-Xylosidase, XylC, from Thermoanaerobacterium saccharolyticum JW/SL-YS485. Appl Environ Microbiol 77(3):719–726

    Article  Google Scholar 

  • Wong KK, Tan LU, Saddler JN (1988) Multiplicity of beta-1,4 xylanase in microorganisms: functions and applications. Microbiol Rev 52(3):305–317

    CAS  PubMed  PubMed Central  Google Scholar 

  • Xinzhou Y, Pengjun S, Huoqing H, Huiying L, Yaru W, Wei Z, Bin Y (2014) Two xylose-tolerant GH43 bifunctional β-xylosidase/α-arabinosidases and one GH11 xylanase from Humicola insolens and their synergy in the degradation of xylan. Food Chem 148:381–387

    Article  Google Scholar 

  • Xu WZ, Shima Y, Negoro S, Urabe I (1991) Sequence and properties of beta-xylosidase from Bacillus pumilus IPO. Contradiction of the previous nucleotide sequence. Eur J Biochem 202(3):1197–1203

    Article  CAS  PubMed  Google Scholar 

  • Yan QJ, Wang L, Jiang ZQ, Yang SQ, Zhu HF, Li LT (2008) A xylose-tolerant β-xylosidase from Paecilomyces thermophila: characterization and its co-action with the endogenous xylanase. Bioresour Technol 99:5402–5410

    Article  CAS  PubMed  Google Scholar 

  • Zanoelo FF, Polizeli Md Mde L, Terenzi HF, Jorge JA (2004) Purification and biochemical properties of a thermostable xylose-tolerant β-D-xylosidase from Scytalidium thermophilum. J Ind Microbiol Biotechnol 31:170–176

    Article  CAS  PubMed  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. School of Bioscience and Bioengineering, South China University of Technology, Guangzhou, 510006, Guangdong, China

    Jiashi Zhang, Tangbing Cui & Xueqing Li

Authors
  1. Jiashi Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Tangbing Cui
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xueqing Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Tangbing Cui.

Ethics declarations

Conflict of interest

The authors declare that they have no conflicts of interest.

Research involving human participants and/or animals

Not applicable.

Informed consent

Not applicable.

Ethics approval

Not applicable.

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhang, J., Cui, T. & Li, X. Screening and identification of an Enterobacter ludwigii strain expressing an active β-xylosidase. Ann Microbiol 68, 261–271 (2018). https://doi.org/10.1007/s13213-018-1334-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s13213-018-1334-2

Keywords

Annals of Microbiology

ISSN: 1869-2044

Contact us